Incidental Mutation 'R5303:Pih1d3'
ID404323
Institutional Source Beutler Lab
Gene Symbol Pih1d3
Ensembl Gene ENSMUSG00000026063
Gene NamePIH1 domain containing 3
Synonyms4930521A18Rik
MMRRC Submission 042886-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5303 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location31222838-31224288 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 31223456 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 173 (R173H)
Ref Sequence ENSEMBL: ENSMUSP00000127665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027230] [ENSMUST00000127775] [ENSMUST00000135245] [ENSMUST00000187659]
Predicted Effect probably damaging
Transcript: ENSMUST00000027230
AA Change: R173H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127665
Gene: ENSMUSG00000026063
AA Change: R173H

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
Pfam:PIH1 70 209 2.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127775
SMART Domains Protein: ENSMUSP00000120381
Gene: ENSMUSG00000086727

DomainStartEndE-ValueType
low complexity region 55 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135245
SMART Domains Protein: ENSMUSP00000120289
Gene: ENSMUSG00000086727

DomainStartEndE-ValueType
low complexity region 55 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187659
SMART Domains Protein: ENSMUSP00000139710
Gene: ENSMUSG00000086727

DomainStartEndE-ValueType
low complexity region 55 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187892
Meta Mutation Damage Score 0.1966 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (63/64)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele develop normally but display male infertility associated with asthenozoospermia and abnormal sperm flagellum morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,406,350 G531A probably damaging Het
2410089E03Rik G A 15: 8,260,690 probably null Het
4921504E06Rik A G 2: 19,516,299 Y256H possibly damaging Het
Abcc12 C A 8: 86,509,786 R1133L probably benign Het
Acss3 T A 10: 107,084,851 T133S possibly damaging Het
Adra1d G A 2: 131,546,249 P462L possibly damaging Het
Ank2 A T 3: 126,945,804 probably benign Het
Arid2 G A 15: 96,392,468 R1748Q probably damaging Het
B3glct C T 5: 149,754,023 probably benign Het
C3ar1 A T 6: 122,849,835 S474R probably damaging Het
Cd1d1 A G 3: 86,998,120 F189L probably benign Het
Cd46 T C 1: 195,062,399 I344V probably benign Het
Chrna1 T C 2: 73,566,274 M426V probably benign Het
Cinp G A 12: 110,876,861 T139M probably damaging Het
Disp2 T C 2: 118,810,848 probably benign Het
Eapp G A 12: 54,692,918 P38L probably damaging Het
Eif4g3 T C 4: 138,126,562 S480P probably benign Het
Epb41l3 G C 17: 69,257,449 E390Q probably damaging Het
Fermt1 T C 2: 132,911,339 probably null Het
Foxf2 T A 13: 31,626,480 F134Y possibly damaging Het
Foxp2 T A 6: 15,324,637 C95S probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gria1 A G 11: 57,243,025 T577A probably benign Het
Hal A G 10: 93,516,365 probably benign Het
Hdac7 C A 15: 97,798,018 E670D probably damaging Het
Islr2 A T 9: 58,208,275 probably benign Het
Itpr3 T C 17: 27,116,689 Y2258H probably benign Het
Mical3 G T 6: 120,959,980 T1195K probably benign Het
Myh1 T C 11: 67,202,017 S46P probably benign Het
Mylk3 T A 8: 85,350,476 I444F probably damaging Het
Nlrc3 A T 16: 3,963,614 C644S probably benign Het
Notch1 C T 2: 26,478,619 V553M probably benign Het
Olfr1245 T A 2: 89,575,001 I242F possibly damaging Het
Olfr1454 T A 19: 13,063,775 Y121* probably null Het
Olfr644 T C 7: 104,069,032 probably benign Het
Olfr979 A G 9: 40,000,588 I213T probably damaging Het
Postn A G 3: 54,377,597 T669A probably damaging Het
Ppp5c G T 7: 17,005,284 Q472K probably benign Het
Qsox1 T C 1: 155,779,293 H708R probably benign Het
Rhbdl2 A G 4: 123,810,221 probably benign Het
Ryr1 C T 7: 29,068,482 E2884K probably damaging Het
Saysd1 T C 14: 20,082,958 T44A probably benign Het
Sept14 T A 5: 129,689,648 M290L possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc38a8 C A 8: 119,486,041 V294L possibly damaging Het
Spdye4b C T 5: 143,202,403 T217I probably benign Het
Sugp2 T A 8: 70,242,177 probably benign Het
Syne1 T C 10: 5,420,464 T232A probably benign Het
Tbc1d5 A T 17: 50,736,200 D753E probably benign Het
Tmed1 G T 9: 21,510,047 Q44K possibly damaging Het
Ttc6 T A 12: 57,575,820 S2T possibly damaging Het
Ube4b T C 4: 149,383,803 D172G probably damaging Het
Vmn1r235 C A 17: 21,262,006 Q198K probably benign Het
Wdfy3 T C 5: 101,952,983 H256R probably damaging Het
Zfat A T 15: 68,110,486 H1059Q probably damaging Het
Zfp758 A G 17: 22,374,861 I77M probably benign Het
Zfp850 C T 7: 28,008,413 A2T probably damaging Het
Zfyve1 A T 12: 83,575,056 N188K probably damaging Het
Zyg11a C T 4: 108,184,432 probably null Het
Other mutations in Pih1d3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Pih1d3 APN 1 31222972 missense probably benign 0.00
IGL01469:Pih1d3 APN 1 31223429 missense probably damaging 0.99
IGL01629:Pih1d3 APN 1 31222933 utr 5 prime probably null
IGL02545:Pih1d3 APN 1 31223096 missense probably damaging 0.99
R1263:Pih1d3 UTSW 1 31223215 missense probably damaging 1.00
R1477:Pih1d3 UTSW 1 31223023 missense probably benign 0.08
R2073:Pih1d3 UTSW 1 31222996 missense probably benign 0.01
R4459:Pih1d3 UTSW 1 31223324 missense probably damaging 1.00
R5289:Pih1d3 UTSW 1 31223527 missense probably benign 0.02
R6216:Pih1d3 UTSW 1 31223351 missense probably damaging 1.00
R6994:Pih1d3 UTSW 1 31222909 unclassified probably benign
R7372:Pih1d3 UTSW 1 31223351 missense probably damaging 1.00
R8127:Pih1d3 UTSW 1 31223120 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGGATGTTCGTGAAATTCCAG -3'
(R):5'- GAACCTTTCTAAAATATGTCGGGG -3'

Sequencing Primer
(F):5'- GGATGTTCGTGAAATTCCAGATTATG -3'
(R):5'- GGGAGAACATAAACAACCAGTATTC -3'
Posted On2016-07-22