Incidental Mutation 'R5303:Qsox1'
ID404325
Institutional Source Beutler Lab
Gene Symbol Qsox1
Ensembl Gene ENSMUSG00000033684
Gene Namequiescin Q6 sulfhydryl oxidase 1
SynonymsQscn6, QSOX, 1300003H02Rik
MMRRC Submission 042886-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.591) question?
Stock #R5303 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location155776029-155812889 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 155779293 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 708 (H708R)
Ref Sequence ENSEMBL: ENSMUSP00000035658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035325] [ENSMUST00000111764] [ENSMUST00000194632]
PDB Structure
C76A/C455S mutant of mouse QSOX1 containing an interdomain disulfide [X-RAY DIFFRACTION]
C76A/C455S mutant of mouse QSOX1 containing an interdomain disulfide [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000035325
AA Change: H708R

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000035658
Gene: ENSMUSG00000033684
AA Change: H708R

DomainStartEndE-ValueType
low complexity region 5 29 N/A INTRINSIC
Pfam:Thioredoxin 46 149 9e-18 PFAM
low complexity region 276 286 N/A INTRINSIC
Pfam:Evr1_Alr 408 507 7e-29 PFAM
low complexity region 679 692 N/A INTRINSIC
low complexity region 693 705 N/A INTRINSIC
transmembrane domain 709 731 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111764
SMART Domains Protein: ENSMUSP00000107394
Gene: ENSMUSG00000033684

DomainStartEndE-ValueType
low complexity region 5 29 N/A INTRINSIC
Pfam:Thioredoxin 45 149 1.7e-18 PFAM
low complexity region 276 286 N/A INTRINSIC
Pfam:Evr1_Alr 408 508 1.5e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130701
Predicted Effect probably benign
Transcript: ENSMUST00000194632
SMART Domains Protein: ENSMUSP00000142301
Gene: ENSMUSG00000033684

DomainStartEndE-ValueType
low complexity region 5 29 N/A INTRINSIC
Pfam:Thioredoxin 45 149 1.3e-18 PFAM
low complexity region 276 286 N/A INTRINSIC
Pfam:Evr1_Alr 408 508 1.2e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195419
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains domains of thioredoxin and ERV1, members of two long-standing gene families. The gene expression is induced as fibroblasts begin to exit the proliferative cycle and enter quiescence, suggesting that this gene plays an important role in growth regulation. Two transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for an ENU-induced mutation show cardiovascular phenotypes including persistent truncus arteriosus, atriventricular septal defects and vascular ring, as well as eye defects, short snout, micrognathia, cleft palate, tracheosophageal fistula, polydactyly and spleen hypoplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,406,350 G531A probably damaging Het
2410089E03Rik G A 15: 8,260,690 probably null Het
4921504E06Rik A G 2: 19,516,299 Y256H possibly damaging Het
Abcc12 C A 8: 86,509,786 R1133L probably benign Het
Acss3 T A 10: 107,084,851 T133S possibly damaging Het
Adra1d G A 2: 131,546,249 P462L possibly damaging Het
Ank2 A T 3: 126,945,804 probably benign Het
Arid2 G A 15: 96,392,468 R1748Q probably damaging Het
B3glct C T 5: 149,754,023 probably benign Het
C3ar1 A T 6: 122,849,835 S474R probably damaging Het
Cd1d1 A G 3: 86,998,120 F189L probably benign Het
Cd46 T C 1: 195,062,399 I344V probably benign Het
Chrna1 T C 2: 73,566,274 M426V probably benign Het
Cinp G A 12: 110,876,861 T139M probably damaging Het
Disp2 T C 2: 118,810,848 probably benign Het
Eapp G A 12: 54,692,918 P38L probably damaging Het
Eif4g3 T C 4: 138,126,562 S480P probably benign Het
Epb41l3 G C 17: 69,257,449 E390Q probably damaging Het
Fermt1 T C 2: 132,911,339 probably null Het
Foxf2 T A 13: 31,626,480 F134Y possibly damaging Het
Foxp2 T A 6: 15,324,637 C95S probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gria1 A G 11: 57,243,025 T577A probably benign Het
Hal A G 10: 93,516,365 probably benign Het
Hdac7 C A 15: 97,798,018 E670D probably damaging Het
Islr2 A T 9: 58,208,275 probably benign Het
Itpr3 T C 17: 27,116,689 Y2258H probably benign Het
Mical3 G T 6: 120,959,980 T1195K probably benign Het
Myh1 T C 11: 67,202,017 S46P probably benign Het
Mylk3 T A 8: 85,350,476 I444F probably damaging Het
Nlrc3 A T 16: 3,963,614 C644S probably benign Het
Notch1 C T 2: 26,478,619 V553M probably benign Het
Olfr1245 T A 2: 89,575,001 I242F possibly damaging Het
Olfr1454 T A 19: 13,063,775 Y121* probably null Het
Olfr644 T C 7: 104,069,032 probably benign Het
Olfr979 A G 9: 40,000,588 I213T probably damaging Het
Pih1d3 G A 1: 31,223,456 R173H probably damaging Het
Postn A G 3: 54,377,597 T669A probably damaging Het
Ppp5c G T 7: 17,005,284 Q472K probably benign Het
Rhbdl2 A G 4: 123,810,221 probably benign Het
Ryr1 C T 7: 29,068,482 E2884K probably damaging Het
Saysd1 T C 14: 20,082,958 T44A probably benign Het
Sept14 T A 5: 129,689,648 M290L possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc38a8 C A 8: 119,486,041 V294L possibly damaging Het
Spdye4b C T 5: 143,202,403 T217I probably benign Het
Sugp2 T A 8: 70,242,177 probably benign Het
Syne1 T C 10: 5,420,464 T232A probably benign Het
Tbc1d5 A T 17: 50,736,200 D753E probably benign Het
Tmed1 G T 9: 21,510,047 Q44K possibly damaging Het
Ttc6 T A 12: 57,575,820 S2T possibly damaging Het
Ube4b T C 4: 149,383,803 D172G probably damaging Het
Vmn1r235 C A 17: 21,262,006 Q198K probably benign Het
Wdfy3 T C 5: 101,952,983 H256R probably damaging Het
Zfat A T 15: 68,110,486 H1059Q probably damaging Het
Zfp758 A G 17: 22,374,861 I77M probably benign Het
Zfp850 C T 7: 28,008,413 A2T probably damaging Het
Zfyve1 A T 12: 83,575,056 N188K probably damaging Het
Zyg11a C T 4: 108,184,432 probably null Het
Other mutations in Qsox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02392:Qsox1 APN 1 155812600 missense probably damaging 1.00
R1799:Qsox1 UTSW 1 155794618 missense probably null
R1833:Qsox1 UTSW 1 155791045 missense probably benign 0.15
R1874:Qsox1 UTSW 1 155812639 missense possibly damaging 0.85
R4282:Qsox1 UTSW 1 155786925 critical splice acceptor site probably null
R4938:Qsox1 UTSW 1 155779668 missense probably benign 0.01
R5081:Qsox1 UTSW 1 155812835 utr 5 prime probably benign
R5217:Qsox1 UTSW 1 155790996 missense probably benign 0.00
R5761:Qsox1 UTSW 1 155779528 missense probably benign
R5763:Qsox1 UTSW 1 155779879 missense probably benign
R5932:Qsox1 UTSW 1 155789333 missense probably benign
R6765:Qsox1 UTSW 1 155791105 missense probably benign 0.00
R6802:Qsox1 UTSW 1 155795393 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCACTCTCCTAAGCTAGAC -3'
(R):5'- GGCAGCAACACTTGAGCAAG -3'

Sequencing Primer
(F):5'- TCCTAAGCTAGACAACAGAACAAGGG -3'
(R):5'- GAGAGACACTGAAGCCTTATTTCTGC -3'
Posted On2016-07-22