Incidental Mutation 'R5303:Cd46'
ID404326
Institutional Source Beutler Lab
Gene Symbol Cd46
Ensembl Gene ENSMUSG00000016493
Gene NameCD46 antigen, complement regulatory protein
SynonymsCD46, Mcp
MMRRC Submission 042886-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5303 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location195036826-195092249 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 195062399 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 344 (I344V)
Ref Sequence ENSEMBL: ENSMUSP00000123931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159563] [ENSMUST00000162650]
Predicted Effect probably benign
Transcript: ENSMUST00000159563
SMART Domains Protein: ENSMUSP00000123901
Gene: ENSMUSG00000016493

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
CCP 45 104 6.7e-3 SMART
CCP 109 168 3.87e-8 SMART
CCP 173 234 2.14e-10 SMART
CCP 239 294 1.06e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161772
Predicted Effect probably benign
Transcript: ENSMUST00000162650
AA Change: I344V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123931
Gene: ENSMUSG00000016493
AA Change: I344V

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
CCP 45 104 6.7e-3 SMART
CCP 109 168 3.87e-8 SMART
CCP 173 234 2.14e-10 SMART
CCP 239 294 1.06e-14 SMART
transmembrane domain 328 350 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162951
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I membrane protein and is a regulatory part of the complement system. The encoded protein has cofactor activity for inactivation of complement components C3b and C4b by serum factor I, which protects the host cell from damage by complement. In addition, the encoded protein can act as a receptor for the Edmonston strain of measles virus, human herpesvirus-6, and type IV pili of pathogenic Neisseria. Finally, the protein encoded by this gene may be involved in the fusion of the spermatozoa with the oocyte during fertilization. Mutations at this locus have been associated with susceptibility to hemolytic uremic syndrome. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygous mutation of this gene results in increased litter sizes sired by mutant males. Another homozygous null mouse shows increased susceptibility to induced choroid neovascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,406,350 G531A probably damaging Het
2410089E03Rik G A 15: 8,260,690 probably null Het
4921504E06Rik A G 2: 19,516,299 Y256H possibly damaging Het
Abcc12 C A 8: 86,509,786 R1133L probably benign Het
Acss3 T A 10: 107,084,851 T133S possibly damaging Het
Adra1d G A 2: 131,546,249 P462L possibly damaging Het
Ank2 A T 3: 126,945,804 probably benign Het
Arid2 G A 15: 96,392,468 R1748Q probably damaging Het
B3glct C T 5: 149,754,023 probably benign Het
C3ar1 A T 6: 122,849,835 S474R probably damaging Het
Cd1d1 A G 3: 86,998,120 F189L probably benign Het
Chrna1 T C 2: 73,566,274 M426V probably benign Het
Cinp G A 12: 110,876,861 T139M probably damaging Het
Disp2 T C 2: 118,810,848 probably benign Het
Eapp G A 12: 54,692,918 P38L probably damaging Het
Eif4g3 T C 4: 138,126,562 S480P probably benign Het
Epb41l3 G C 17: 69,257,449 E390Q probably damaging Het
Fermt1 T C 2: 132,911,339 probably null Het
Foxf2 T A 13: 31,626,480 F134Y possibly damaging Het
Foxp2 T A 6: 15,324,637 C95S probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gria1 A G 11: 57,243,025 T577A probably benign Het
Hal A G 10: 93,516,365 probably benign Het
Hdac7 C A 15: 97,798,018 E670D probably damaging Het
Islr2 A T 9: 58,208,275 probably benign Het
Itpr3 T C 17: 27,116,689 Y2258H probably benign Het
Mical3 G T 6: 120,959,980 T1195K probably benign Het
Myh1 T C 11: 67,202,017 S46P probably benign Het
Mylk3 T A 8: 85,350,476 I444F probably damaging Het
Nlrc3 A T 16: 3,963,614 C644S probably benign Het
Notch1 C T 2: 26,478,619 V553M probably benign Het
Olfr1245 T A 2: 89,575,001 I242F possibly damaging Het
Olfr1454 T A 19: 13,063,775 Y121* probably null Het
Olfr644 T C 7: 104,069,032 probably benign Het
Olfr979 A G 9: 40,000,588 I213T probably damaging Het
Pih1d3 G A 1: 31,223,456 R173H probably damaging Het
Postn A G 3: 54,377,597 T669A probably damaging Het
Ppp5c G T 7: 17,005,284 Q472K probably benign Het
Qsox1 T C 1: 155,779,293 H708R probably benign Het
Rhbdl2 A G 4: 123,810,221 probably benign Het
Ryr1 C T 7: 29,068,482 E2884K probably damaging Het
Saysd1 T C 14: 20,082,958 T44A probably benign Het
Sept14 T A 5: 129,689,648 M290L possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc38a8 C A 8: 119,486,041 V294L possibly damaging Het
Spdye4b C T 5: 143,202,403 T217I probably benign Het
Sugp2 T A 8: 70,242,177 probably benign Het
Syne1 T C 10: 5,420,464 T232A probably benign Het
Tbc1d5 A T 17: 50,736,200 D753E probably benign Het
Tmed1 G T 9: 21,510,047 Q44K possibly damaging Het
Ttc6 T A 12: 57,575,820 S2T possibly damaging Het
Ube4b T C 4: 149,383,803 D172G probably damaging Het
Vmn1r235 C A 17: 21,262,006 Q198K probably benign Het
Wdfy3 T C 5: 101,952,983 H256R probably damaging Het
Zfat A T 15: 68,110,486 H1059Q probably damaging Het
Zfp758 A G 17: 22,374,861 I77M probably benign Het
Zfp850 C T 7: 28,008,413 A2T probably damaging Het
Zfyve1 A T 12: 83,575,056 N188K probably damaging Het
Zyg11a C T 4: 108,184,432 probably null Het
Other mutations in Cd46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02429:Cd46 APN 1 195085424 missense probably benign 0.01
IGL03029:Cd46 APN 1 195086143 missense probably benign 0.43
R0269:Cd46 UTSW 1 195064688 missense probably benign 0.00
R0375:Cd46 UTSW 1 195086164 missense probably benign 0.00
R0627:Cd46 UTSW 1 195092186 missense probably benign 0.03
R0784:Cd46 UTSW 1 195092194 missense possibly damaging 0.96
R0892:Cd46 UTSW 1 195082612 missense possibly damaging 0.78
R0973:Cd46 UTSW 1 195041992 makesense probably null
R0973:Cd46 UTSW 1 195041992 makesense probably null
R0974:Cd46 UTSW 1 195041992 makesense probably null
R1224:Cd46 UTSW 1 195062398 missense possibly damaging 0.66
R1716:Cd46 UTSW 1 195077809 missense probably benign 0.21
R1863:Cd46 UTSW 1 195083623 missense probably damaging 1.00
R2000:Cd46 UTSW 1 195077704 missense probably benign 0.00
R2152:Cd46 UTSW 1 195062413 missense probably benign 0.42
R2153:Cd46 UTSW 1 195062413 missense probably benign 0.42
R4452:Cd46 UTSW 1 195085360 missense possibly damaging 0.84
R4860:Cd46 UTSW 1 195062396 missense possibly damaging 0.94
R4860:Cd46 UTSW 1 195062396 missense possibly damaging 0.94
R4934:Cd46 UTSW 1 195082799 intron probably benign
R5156:Cd46 UTSW 1 195085385 missense possibly damaging 0.90
R5287:Cd46 UTSW 1 195062411 missense possibly damaging 0.65
R5403:Cd46 UTSW 1 195062411 missense possibly damaging 0.65
R5487:Cd46 UTSW 1 195068170 critical splice acceptor site probably null
R5505:Cd46 UTSW 1 195085380 missense possibly damaging 0.88
R5538:Cd46 UTSW 1 195068170 critical splice acceptor site probably null
R6721:Cd46 UTSW 1 195083631 missense probably damaging 1.00
R6731:Cd46 UTSW 1 195083467 intron probably null
R7226:Cd46 UTSW 1 195042006 missense possibly damaging 0.84
R7633:Cd46 UTSW 1 195083619 missense probably null 0.01
Predicted Primers PCR Primer
(F):5'- ACACAGATCCTTATGCTGCAATGATG -3'
(R):5'- CCCTGTAGTTCCAGCTACACAG -3'

Sequencing Primer
(F):5'- GCTGCAATGATGTCAAAATAGTTG -3'
(R):5'- GCTACACAGAGAAACCCTGTCTTG -3'
Posted On2016-07-22