Incidental Mutation 'R5303:Fermt1'
ID404334
Institutional Source Beutler Lab
Gene Symbol Fermt1
Ensembl Gene ENSMUSG00000027356
Gene Namefermitin family member 1
SynonymsKindlin-1, 5830467P10Rik
MMRRC Submission 042886-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5303 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location132904389-132945906 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 132911339 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000047616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038280] [ENSMUST00000038280]
PDB Structure
Solution Structure of the N-terminal domain of kindlin-1 [SOLUTION NMR]
Structural and functional characterisation of the kindlin-1 pleckstrin homology domain [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000038280
SMART Domains Protein: ENSMUSP00000047616
Gene: ENSMUSG00000027356

DomainStartEndE-ValueType
Blast:B41 10 74 2e-16 BLAST
B41 91 570 1.39e-30 SMART
PH 370 475 2.81e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000038280
SMART Domains Protein: ENSMUSP00000047616
Gene: ENSMUSG00000027356

DomainStartEndE-ValueType
Blast:B41 10 74 2e-16 BLAST
B41 91 570 1.39e-30 SMART
PH 370 475 2.81e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134937
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fermitin family, and contains a FERM domain and a pleckstrin homology domain. The encoded protein is involved in integrin signaling and linkage of the actin cytoskeleton to the extracellular matrix. Mutations in this gene have been linked to Kindler syndrome. [provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality within 5 days of birth, dehydration, detachment of colonic epithelial cells, and colonic inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,406,350 G531A probably damaging Het
2410089E03Rik G A 15: 8,260,690 probably null Het
4921504E06Rik A G 2: 19,516,299 Y256H possibly damaging Het
Abcc12 C A 8: 86,509,786 R1133L probably benign Het
Acss3 T A 10: 107,084,851 T133S possibly damaging Het
Adra1d G A 2: 131,546,249 P462L possibly damaging Het
Ank2 A T 3: 126,945,804 probably benign Het
Arid2 G A 15: 96,392,468 R1748Q probably damaging Het
B3glct C T 5: 149,754,023 probably benign Het
C3ar1 A T 6: 122,849,835 S474R probably damaging Het
Cd1d1 A G 3: 86,998,120 F189L probably benign Het
Cd46 T C 1: 195,062,399 I344V probably benign Het
Chrna1 T C 2: 73,566,274 M426V probably benign Het
Cinp G A 12: 110,876,861 T139M probably damaging Het
Disp2 T C 2: 118,810,848 probably benign Het
Eapp G A 12: 54,692,918 P38L probably damaging Het
Eif4g3 T C 4: 138,126,562 S480P probably benign Het
Epb41l3 G C 17: 69,257,449 E390Q probably damaging Het
Foxf2 T A 13: 31,626,480 F134Y possibly damaging Het
Foxp2 T A 6: 15,324,637 C95S probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gria1 A G 11: 57,243,025 T577A probably benign Het
Hal A G 10: 93,516,365 probably benign Het
Hdac7 C A 15: 97,798,018 E670D probably damaging Het
Islr2 A T 9: 58,208,275 probably benign Het
Itpr3 T C 17: 27,116,689 Y2258H probably benign Het
Mical3 G T 6: 120,959,980 T1195K probably benign Het
Myh1 T C 11: 67,202,017 S46P probably benign Het
Mylk3 T A 8: 85,350,476 I444F probably damaging Het
Nlrc3 A T 16: 3,963,614 C644S probably benign Het
Notch1 C T 2: 26,478,619 V553M probably benign Het
Olfr1245 T A 2: 89,575,001 I242F possibly damaging Het
Olfr1454 T A 19: 13,063,775 Y121* probably null Het
Olfr644 T C 7: 104,069,032 probably benign Het
Olfr979 A G 9: 40,000,588 I213T probably damaging Het
Pih1d3 G A 1: 31,223,456 R173H probably damaging Het
Postn A G 3: 54,377,597 T669A probably damaging Het
Ppp5c G T 7: 17,005,284 Q472K probably benign Het
Qsox1 T C 1: 155,779,293 H708R probably benign Het
Rhbdl2 A G 4: 123,810,221 probably benign Het
Ryr1 C T 7: 29,068,482 E2884K probably damaging Het
Saysd1 T C 14: 20,082,958 T44A probably benign Het
Sept14 T A 5: 129,689,648 M290L possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc38a8 C A 8: 119,486,041 V294L possibly damaging Het
Spdye4b C T 5: 143,202,403 T217I probably benign Het
Sugp2 T A 8: 70,242,177 probably benign Het
Syne1 T C 10: 5,420,464 T232A probably benign Het
Tbc1d5 A T 17: 50,736,200 D753E probably benign Het
Tmed1 G T 9: 21,510,047 Q44K possibly damaging Het
Ttc6 T A 12: 57,575,820 S2T possibly damaging Het
Ube4b T C 4: 149,383,803 D172G probably damaging Het
Vmn1r235 C A 17: 21,262,006 Q198K probably benign Het
Wdfy3 T C 5: 101,952,983 H256R probably damaging Het
Zfat A T 15: 68,110,486 H1059Q probably damaging Het
Zfp758 A G 17: 22,374,861 I77M probably benign Het
Zfp850 C T 7: 28,008,413 A2T probably damaging Het
Zfyve1 A T 12: 83,575,056 N188K probably damaging Het
Zyg11a C T 4: 108,184,432 probably null Het
Other mutations in Fermt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02391:Fermt1 APN 2 132941951 missense probably damaging 1.00
IGL02511:Fermt1 APN 2 132933166 splice site probably benign
IGL02591:Fermt1 APN 2 132934866 missense possibly damaging 0.89
IGL03107:Fermt1 APN 2 132933139 missense probably damaging 1.00
R0691:Fermt1 UTSW 2 132906733 missense probably damaging 0.99
R1386:Fermt1 UTSW 2 132916058 missense probably damaging 0.99
R1468:Fermt1 UTSW 2 132925022 missense probably benign 0.16
R1468:Fermt1 UTSW 2 132925022 missense probably benign 0.16
R1474:Fermt1 UTSW 2 132925022 missense probably benign 0.16
R1510:Fermt1 UTSW 2 132925022 missense probably benign 0.16
R1558:Fermt1 UTSW 2 132934819 critical splice donor site probably null
R1625:Fermt1 UTSW 2 132922831 missense probably damaging 1.00
R1917:Fermt1 UTSW 2 132922842 missense probably damaging 1.00
R2026:Fermt1 UTSW 2 132918525 missense probably benign 0.11
R2264:Fermt1 UTSW 2 132915190 critical splice donor site probably null
R2512:Fermt1 UTSW 2 132939518 splice site probably null
R3765:Fermt1 UTSW 2 132906702 missense possibly damaging 0.55
R4914:Fermt1 UTSW 2 132906840 missense probably damaging 1.00
R5184:Fermt1 UTSW 2 132941963 missense possibly damaging 0.50
R5259:Fermt1 UTSW 2 132906765 missense probably damaging 0.99
R5304:Fermt1 UTSW 2 132942066 missense probably benign 0.00
R5404:Fermt1 UTSW 2 132934869 missense possibly damaging 0.55
R5569:Fermt1 UTSW 2 132915203 missense possibly damaging 0.89
R7146:Fermt1 UTSW 2 132934865 missense probably benign 0.02
R7401:Fermt1 UTSW 2 132917559 missense probably benign
R7561:Fermt1 UTSW 2 132916088 missense probably benign 0.02
X0013:Fermt1 UTSW 2 132918586 missense probably damaging 0.96
Z1176:Fermt1 UTSW 2 132906756 missense probably damaging 1.00
Z1176:Fermt1 UTSW 2 132936018 missense probably benign 0.42
Z1176:Fermt1 UTSW 2 132941943 missense probably benign
Predicted Primers PCR Primer
(F):5'- AATCGGAAGCTCTGCCTCAC -3'
(R):5'- GTGGCCTTTAAGAAACTGCATG -3'

Sequencing Primer
(F):5'- ACCTGCCGGATTTCCCAG -3'
(R):5'- CCTTTAAGAAACTGCATGTGGGGC -3'
Posted On2016-07-22