Incidental Mutation 'R5303:Rhbdl2'
ID404339
Institutional Source Beutler Lab
Gene Symbol Rhbdl2
Ensembl Gene ENSMUSG00000043333
Gene Namerhomboid like 2
Synonyms
MMRRC Submission 042886-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5303 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location123787874-123829904 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 123810221 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053202] [ENSMUST00000106204]
Predicted Effect probably benign
Transcript: ENSMUST00000053202
SMART Domains Protein: ENSMUSP00000054546
Gene: ENSMUSG00000043333

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Rhomboid 113 268 7.1e-39 PFAM
transmembrane domain 277 299 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106204
SMART Domains Protein: ENSMUSP00000101810
Gene: ENSMUSG00000043333

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Rhomboid 113 268 1.8e-38 PFAM
transmembrane domain 277 299 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150286
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the rhomboid family of integral membrane proteins. This family contains proteins that are related to Drosophila rhomboid protein. Members of this family are found in both prokaryotes and eukaryotes and are thought to function as intramembrane serine proteases. The encoded protein is thought to release soluble growth factors by proteolytic cleavage of certain membrane-bound substrates, including ephrin B2 and ephrin B3. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,406,350 G531A probably damaging Het
2410089E03Rik G A 15: 8,260,690 probably null Het
4921504E06Rik A G 2: 19,516,299 Y256H possibly damaging Het
Abcc12 C A 8: 86,509,786 R1133L probably benign Het
Acss3 T A 10: 107,084,851 T133S possibly damaging Het
Adra1d G A 2: 131,546,249 P462L possibly damaging Het
Ank2 A T 3: 126,945,804 probably benign Het
Arid2 G A 15: 96,392,468 R1748Q probably damaging Het
B3glct C T 5: 149,754,023 probably benign Het
C3ar1 A T 6: 122,849,835 S474R probably damaging Het
Cd1d1 A G 3: 86,998,120 F189L probably benign Het
Cd46 T C 1: 195,062,399 I344V probably benign Het
Chrna1 T C 2: 73,566,274 M426V probably benign Het
Cinp G A 12: 110,876,861 T139M probably damaging Het
Disp2 T C 2: 118,810,848 probably benign Het
Eapp G A 12: 54,692,918 P38L probably damaging Het
Eif4g3 T C 4: 138,126,562 S480P probably benign Het
Epb41l3 G C 17: 69,257,449 E390Q probably damaging Het
Fermt1 T C 2: 132,911,339 probably null Het
Foxf2 T A 13: 31,626,480 F134Y possibly damaging Het
Foxp2 T A 6: 15,324,637 C95S probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gria1 A G 11: 57,243,025 T577A probably benign Het
Hal A G 10: 93,516,365 probably benign Het
Hdac7 C A 15: 97,798,018 E670D probably damaging Het
Islr2 A T 9: 58,208,275 probably benign Het
Itpr3 T C 17: 27,116,689 Y2258H probably benign Het
Mical3 G T 6: 120,959,980 T1195K probably benign Het
Myh1 T C 11: 67,202,017 S46P probably benign Het
Mylk3 T A 8: 85,350,476 I444F probably damaging Het
Nlrc3 A T 16: 3,963,614 C644S probably benign Het
Notch1 C T 2: 26,478,619 V553M probably benign Het
Olfr1245 T A 2: 89,575,001 I242F possibly damaging Het
Olfr1454 T A 19: 13,063,775 Y121* probably null Het
Olfr644 T C 7: 104,069,032 probably benign Het
Olfr979 A G 9: 40,000,588 I213T probably damaging Het
Pih1d3 G A 1: 31,223,456 R173H probably damaging Het
Postn A G 3: 54,377,597 T669A probably damaging Het
Ppp5c G T 7: 17,005,284 Q472K probably benign Het
Qsox1 T C 1: 155,779,293 H708R probably benign Het
Ryr1 C T 7: 29,068,482 E2884K probably damaging Het
Saysd1 T C 14: 20,082,958 T44A probably benign Het
Sept14 T A 5: 129,689,648 M290L possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc38a8 C A 8: 119,486,041 V294L possibly damaging Het
Spdye4b C T 5: 143,202,403 T217I probably benign Het
Sugp2 T A 8: 70,242,177 probably benign Het
Syne1 T C 10: 5,420,464 T232A probably benign Het
Tbc1d5 A T 17: 50,736,200 D753E probably benign Het
Tmed1 G T 9: 21,510,047 Q44K possibly damaging Het
Ttc6 T A 12: 57,575,820 S2T possibly damaging Het
Ube4b T C 4: 149,383,803 D172G probably damaging Het
Vmn1r235 C A 17: 21,262,006 Q198K probably benign Het
Wdfy3 T C 5: 101,952,983 H256R probably damaging Het
Zfat A T 15: 68,110,486 H1059Q probably damaging Het
Zfp758 A G 17: 22,374,861 I77M probably benign Het
Zfp850 C T 7: 28,008,413 A2T probably damaging Het
Zfyve1 A T 12: 83,575,056 N188K probably damaging Het
Zyg11a C T 4: 108,184,432 probably null Het
Other mutations in Rhbdl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Rhbdl2 APN 4 123829657 missense probably benign
IGL02111:Rhbdl2 APN 4 123822837 missense probably damaging 1.00
IGL03381:Rhbdl2 APN 4 123822817 missense possibly damaging 0.84
IGL03410:Rhbdl2 APN 4 123829670 nonsense probably null
R0039:Rhbdl2 UTSW 4 123810029 missense probably benign 0.02
R1292:Rhbdl2 UTSW 4 123829642 missense possibly damaging 0.69
R2024:Rhbdl2 UTSW 4 123826872 missense probably damaging 1.00
R2120:Rhbdl2 UTSW 4 123824919 missense probably damaging 1.00
R4364:Rhbdl2 UTSW 4 123809935 start codon destroyed probably null 0.87
R4366:Rhbdl2 UTSW 4 123809935 start codon destroyed probably null 0.87
R4413:Rhbdl2 UTSW 4 123810087 missense probably benign 0.04
R4749:Rhbdl2 UTSW 4 123826901 critical splice donor site probably null
R5069:Rhbdl2 UTSW 4 123817917 nonsense probably null
R5951:Rhbdl2 UTSW 4 123814327 missense probably benign 0.00
R7147:Rhbdl2 UTSW 4 123810115 missense probably damaging 1.00
R7171:Rhbdl2 UTSW 4 123814256 missense possibly damaging 0.95
R7337:Rhbdl2 UTSW 4 123817866 missense possibly damaging 0.91
R7374:Rhbdl2 UTSW 4 123817865 missense probably benign 0.01
R7411:Rhbdl2 UTSW 4 123829642 missense possibly damaging 0.69
R7718:Rhbdl2 UTSW 4 123824919 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTCCCCAGGAGCAGAAAG -3'
(R):5'- AGGTTTCTAAAGATCGCTCTAGC -3'

Sequencing Primer
(F):5'- GAAAGGTCCACAGGATCGTCTCC -3'
(R):5'- GATCGCTCTAGCTAAAACGAAATG -3'
Posted On2016-07-22