Incidental Mutation 'R5303:Mylk3'
ID404354
Institutional Source Beutler Lab
Gene Symbol Mylk3
Ensembl Gene ENSMUSG00000031698
Gene Namemyosin light chain kinase 3
Synonyms
MMRRC Submission 042886-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.284) question?
Stock #R5303 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location85324303-85386345 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85350476 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 444 (I444F)
Ref Sequence ENSEMBL: ENSMUSP00000113389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034133] [ENSMUST00000121972] [ENSMUST00000122452]
Predicted Effect probably damaging
Transcript: ENSMUST00000034133
AA Change: I577F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034133
Gene: ENSMUSG00000031698
AA Change: I577F

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 304 316 N/A INTRINSIC
S_TKc 491 746 6.93e-91 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121972
AA Change: I514F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113960
Gene: ENSMUSG00000031698
AA Change: I514F

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 241 253 N/A INTRINSIC
S_TKc 428 683 6.93e-91 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122452
AA Change: I444F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113389
Gene: ENSMUSG00000031698
AA Change: I444F

DomainStartEndE-ValueType
low complexity region 171 183 N/A INTRINSIC
S_TKc 358 613 6.93e-91 SMART
Meta Mutation Damage Score 0.6382 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylation of cardiac myosin heavy chains (see MYH7B, MIM 609928) and light chains (see MYL2, MIM 160781) by a kinase, such as MYLK3, potentiates the force and rate of cross-bridge recruitment in cardiac myocytes (Chan et al., 2008 [PubMed 18202317]).[supplied by OMIM, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit cardiac hypertrophy, reduced cardiac function and increased response of heart to induced stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,406,350 G531A probably damaging Het
2410089E03Rik G A 15: 8,260,690 probably null Het
4921504E06Rik A G 2: 19,516,299 Y256H possibly damaging Het
Abcc12 C A 8: 86,509,786 R1133L probably benign Het
Acss3 T A 10: 107,084,851 T133S possibly damaging Het
Adra1d G A 2: 131,546,249 P462L possibly damaging Het
Ank2 A T 3: 126,945,804 probably benign Het
Arid2 G A 15: 96,392,468 R1748Q probably damaging Het
B3glct C T 5: 149,754,023 probably benign Het
C3ar1 A T 6: 122,849,835 S474R probably damaging Het
Cd1d1 A G 3: 86,998,120 F189L probably benign Het
Cd46 T C 1: 195,062,399 I344V probably benign Het
Chrna1 T C 2: 73,566,274 M426V probably benign Het
Cinp G A 12: 110,876,861 T139M probably damaging Het
Disp2 T C 2: 118,810,848 probably benign Het
Eapp G A 12: 54,692,918 P38L probably damaging Het
Eif4g3 T C 4: 138,126,562 S480P probably benign Het
Epb41l3 G C 17: 69,257,449 E390Q probably damaging Het
Fermt1 T C 2: 132,911,339 probably null Het
Foxf2 T A 13: 31,626,480 F134Y possibly damaging Het
Foxp2 T A 6: 15,324,637 C95S probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gria1 A G 11: 57,243,025 T577A probably benign Het
Hal A G 10: 93,516,365 probably benign Het
Hdac7 C A 15: 97,798,018 E670D probably damaging Het
Islr2 A T 9: 58,208,275 probably benign Het
Itpr3 T C 17: 27,116,689 Y2258H probably benign Het
Mical3 G T 6: 120,959,980 T1195K probably benign Het
Myh1 T C 11: 67,202,017 S46P probably benign Het
Nlrc3 A T 16: 3,963,614 C644S probably benign Het
Notch1 C T 2: 26,478,619 V553M probably benign Het
Olfr1245 T A 2: 89,575,001 I242F possibly damaging Het
Olfr1454 T A 19: 13,063,775 Y121* probably null Het
Olfr644 T C 7: 104,069,032 probably benign Het
Olfr979 A G 9: 40,000,588 I213T probably damaging Het
Pih1d3 G A 1: 31,223,456 R173H probably damaging Het
Postn A G 3: 54,377,597 T669A probably damaging Het
Ppp5c G T 7: 17,005,284 Q472K probably benign Het
Qsox1 T C 1: 155,779,293 H708R probably benign Het
Rhbdl2 A G 4: 123,810,221 probably benign Het
Ryr1 C T 7: 29,068,482 E2884K probably damaging Het
Saysd1 T C 14: 20,082,958 T44A probably benign Het
Sept14 T A 5: 129,689,648 M290L possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc38a8 C A 8: 119,486,041 V294L possibly damaging Het
Spdye4b C T 5: 143,202,403 T217I probably benign Het
Sugp2 T A 8: 70,242,177 probably benign Het
Syne1 T C 10: 5,420,464 T232A probably benign Het
Tbc1d5 A T 17: 50,736,200 D753E probably benign Het
Tmed1 G T 9: 21,510,047 Q44K possibly damaging Het
Ttc6 T A 12: 57,575,820 S2T possibly damaging Het
Ube4b T C 4: 149,383,803 D172G probably damaging Het
Vmn1r235 C A 17: 21,262,006 Q198K probably benign Het
Wdfy3 T C 5: 101,952,983 H256R probably damaging Het
Zfat A T 15: 68,110,486 H1059Q probably damaging Het
Zfp758 A G 17: 22,374,861 I77M probably benign Het
Zfp850 C T 7: 28,008,413 A2T probably damaging Het
Zfyve1 A T 12: 83,575,056 N188K probably damaging Het
Zyg11a C T 4: 108,184,432 probably null Het
Other mutations in Mylk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Mylk3 APN 8 85355526 nonsense probably null
IGL01088:Mylk3 APN 8 85351957 splice site probably null
IGL01431:Mylk3 APN 8 85336401 missense probably damaging 1.00
IGL01488:Mylk3 APN 8 85352027 missense probably damaging 1.00
IGL01550:Mylk3 APN 8 85365089 missense probably damaging 1.00
IGL01786:Mylk3 APN 8 85359317 missense probably benign 0.27
IGL01877:Mylk3 APN 8 85359042 missense possibly damaging 0.66
IGL01995:Mylk3 APN 8 85359261 missense possibly damaging 0.83
IGL02003:Mylk3 APN 8 85359098 missense probably benign
IGL02251:Mylk3 APN 8 85355176 missense probably benign 0.04
IGL02252:Mylk3 APN 8 85355476 missense probably benign 0.04
IGL02341:Mylk3 APN 8 85351972 missense probably damaging 1.00
IGL02352:Mylk3 APN 8 85355302 missense probably benign 0.00
IGL02359:Mylk3 APN 8 85355302 missense probably benign 0.00
IGL03000:Mylk3 APN 8 85359177 missense probably damaging 0.97
IGL03185:Mylk3 APN 8 85327204 missense probably damaging 0.97
IGL03404:Mylk3 APN 8 85342681 missense probably damaging 1.00
R0005:Mylk3 UTSW 8 85327203 missense possibly damaging 0.93
R0219:Mylk3 UTSW 8 85355244 missense probably damaging 0.99
R0324:Mylk3 UTSW 8 85352906 missense probably damaging 0.98
R0402:Mylk3 UTSW 8 85352910 missense probably damaging 1.00
R0667:Mylk3 UTSW 8 85355165 critical splice donor site probably null
R1711:Mylk3 UTSW 8 85364831 missense probably damaging 1.00
R1857:Mylk3 UTSW 8 85328594 missense probably damaging 0.98
R1875:Mylk3 UTSW 8 85352865 missense probably damaging 1.00
R1878:Mylk3 UTSW 8 85355399 missense possibly damaging 0.82
R1916:Mylk3 UTSW 8 85327192 missense probably damaging 1.00
R3887:Mylk3 UTSW 8 85352047 missense probably damaging 1.00
R4081:Mylk3 UTSW 8 85328682 missense probably damaging 1.00
R4775:Mylk3 UTSW 8 85359060 nonsense probably null
R4796:Mylk3 UTSW 8 85350385 missense probably damaging 1.00
R4974:Mylk3 UTSW 8 85364783 missense probably damaging 0.97
R5108:Mylk3 UTSW 8 85359092 missense possibly damaging 0.83
R5194:Mylk3 UTSW 8 85352866 missense probably benign 0.26
R5276:Mylk3 UTSW 8 85355442 missense probably damaging 1.00
R5296:Mylk3 UTSW 8 85355431 missense possibly damaging 0.66
R5338:Mylk3 UTSW 8 85342721 missense probably damaging 1.00
R5957:Mylk3 UTSW 8 85328637 missense probably damaging 0.98
R6021:Mylk3 UTSW 8 85364813 missense possibly damaging 0.92
R6294:Mylk3 UTSW 8 85350383 missense probably damaging 1.00
R6305:Mylk3 UTSW 8 85350419 missense probably damaging 1.00
R6376:Mylk3 UTSW 8 85358942 missense possibly damaging 0.53
R6970:Mylk3 UTSW 8 85359263 missense probably damaging 0.97
R7081:Mylk3 UTSW 8 85364793 missense probably benign 0.10
R7170:Mylk3 UTSW 8 85350485 missense probably damaging 1.00
R7318:Mylk3 UTSW 8 85359097 missense probably benign
R7422:Mylk3 UTSW 8 85355244 missense probably benign 0.16
R7503:Mylk3 UTSW 8 85353589 missense probably benign 0.00
R7536:Mylk3 UTSW 8 85353604 missense probably benign 0.05
Z1176:Mylk3 UTSW 8 85365179
Z1177:Mylk3 UTSW 8 85359194 missense probably benign 0.14
Z1177:Mylk3 UTSW 8 85365179
Predicted Primers PCR Primer
(F):5'- ATGACCCATGGGATTGGAATG -3'
(R):5'- ATATGACAGAGCAAAGGCCC -3'

Sequencing Primer
(F):5'- AATGGTGGCCTTGACACAC -3'
(R):5'- AAACCCTACGTAGCAGTGTC -3'
Posted On2016-07-22