Incidental Mutation 'R5303:Or10g9'
ID 404358
Institutional Source Beutler Lab
Gene Symbol Or10g9
Ensembl Gene ENSMUSG00000059473
Gene Name olfactory receptor family 10 subfamily G member 9
Synonyms MOR223-1, Olfr979, GA_x6K02T2PVTD-33699706-33698771
MMRRC Submission 042886-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R5303 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 39911502-39912546 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 39911884 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 213 (I213T)
Ref Sequence ENSEMBL: ENSMUSP00000148903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080835] [ENSMUST00000215523] [ENSMUST00000216463]
AlphaFold Q8VH10
Predicted Effect probably damaging
Transcript: ENSMUST00000080835
AA Change: I213T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079648
Gene: ENSMUSG00000059473
AA Change: I213T

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 7.9e-58 PFAM
Pfam:7tm_1 39 287 5.2e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215523
AA Change: I213T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216463
Meta Mutation Damage Score 0.2482 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,199,999 (GRCm39) G531A probably damaging Het
4921504E06Rik A G 2: 19,521,110 (GRCm39) Y256H possibly damaging Het
Abcc12 C A 8: 87,236,415 (GRCm39) R1133L probably benign Het
Acss3 T A 10: 106,920,712 (GRCm39) T133S possibly damaging Het
Adra1d G A 2: 131,388,169 (GRCm39) P462L possibly damaging Het
Ank2 A T 3: 126,739,453 (GRCm39) probably benign Het
Arid2 G A 15: 96,290,349 (GRCm39) R1748Q probably damaging Het
B3glct C T 5: 149,677,488 (GRCm39) probably benign Het
C3ar1 A T 6: 122,826,794 (GRCm39) S474R probably damaging Het
Cd1d1 A G 3: 86,905,427 (GRCm39) F189L probably benign Het
Cd46 T C 1: 194,744,707 (GRCm39) I344V probably benign Het
Chrna1 T C 2: 73,396,618 (GRCm39) M426V probably benign Het
Cinp G A 12: 110,843,295 (GRCm39) T139M probably damaging Het
Cplane1 G A 15: 8,290,174 (GRCm39) probably null Het
Disp2 T C 2: 118,641,329 (GRCm39) probably benign Het
Dnaaf6rt G A 1: 31,262,537 (GRCm39) R173H probably damaging Het
Eapp G A 12: 54,739,703 (GRCm39) P38L probably damaging Het
Eif4g3 T C 4: 137,853,873 (GRCm39) S480P probably benign Het
Epb41l3 G C 17: 69,564,444 (GRCm39) E390Q probably damaging Het
Fermt1 T C 2: 132,753,259 (GRCm39) probably null Het
Foxf2 T A 13: 31,810,463 (GRCm39) F134Y possibly damaging Het
Foxp2 T A 6: 15,324,636 (GRCm39) C95S probably benign Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
Gria1 A G 11: 57,133,851 (GRCm39) T577A probably benign Het
Hal A G 10: 93,352,227 (GRCm39) probably benign Het
Hdac7 C A 15: 97,695,899 (GRCm39) E670D probably damaging Het
Islr2 A T 9: 58,115,558 (GRCm39) probably benign Het
Itpr3 T C 17: 27,335,663 (GRCm39) Y2258H probably benign Het
Mical3 G T 6: 120,936,941 (GRCm39) T1195K probably benign Het
Myh1 T C 11: 67,092,843 (GRCm39) S46P probably benign Het
Mylk3 T A 8: 86,077,105 (GRCm39) I444F probably damaging Het
Nlrc3 A T 16: 3,781,478 (GRCm39) C644S probably benign Het
Notch1 C T 2: 26,368,631 (GRCm39) V553M probably benign Het
Or4a72 T A 2: 89,405,345 (GRCm39) I242F possibly damaging Het
Or51a43 T C 7: 103,718,239 (GRCm39) probably benign Het
Or5b102 T A 19: 13,041,139 (GRCm39) Y121* probably null Het
Postn A G 3: 54,285,018 (GRCm39) T669A probably damaging Het
Ppp5c G T 7: 16,739,209 (GRCm39) Q472K probably benign Het
Qsox1 T C 1: 155,655,039 (GRCm39) H708R probably benign Het
Rhbdl2 A G 4: 123,704,014 (GRCm39) probably benign Het
Ryr1 C T 7: 28,767,907 (GRCm39) E2884K probably damaging Het
Saysd1 T C 14: 20,133,026 (GRCm39) T44A probably benign Het
Septin14 T A 5: 129,766,712 (GRCm39) M290L possibly damaging Het
Sh3bp5 C A 14: 31,099,452 (GRCm39) R265L probably benign Het
Slc38a8 C A 8: 120,212,780 (GRCm39) V294L possibly damaging Het
Spdye4b C T 5: 143,188,158 (GRCm39) T217I probably benign Het
Sugp2 T A 8: 70,694,827 (GRCm39) probably benign Het
Syne1 T C 10: 5,370,464 (GRCm39) T232A probably benign Het
Tbc1d5 A T 17: 51,043,228 (GRCm39) D753E probably benign Het
Tmed1 G T 9: 21,421,343 (GRCm39) Q44K possibly damaging Het
Ttc6 T A 12: 57,622,606 (GRCm39) S2T possibly damaging Het
Ube4b T C 4: 149,468,260 (GRCm39) D172G probably damaging Het
Vmn1r235 C A 17: 21,482,268 (GRCm39) Q198K probably benign Het
Wdfy3 T C 5: 102,100,849 (GRCm39) H256R probably damaging Het
Zfat A T 15: 67,982,335 (GRCm39) H1059Q probably damaging Het
Zfp758 A G 17: 22,593,842 (GRCm39) I77M probably benign Het
Zfp850 C T 7: 27,707,838 (GRCm39) A2T probably damaging Het
Zfyve1 A T 12: 83,621,830 (GRCm39) N188K probably damaging Het
Zyg11a C T 4: 108,041,629 (GRCm39) probably null Het
Other mutations in Or10g9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02718:Or10g9 APN 9 39,912,182 (GRCm39) missense probably damaging 1.00
IGL02939:Or10g9 APN 9 39,912,194 (GRCm39) missense probably benign 0.26
IGL02991:Or10g9 UTSW 9 39,911,698 (GRCm39) missense probably damaging 1.00
R1388:Or10g9 UTSW 9 39,911,948 (GRCm39) missense probably damaging 0.99
R1572:Or10g9 UTSW 9 39,912,490 (GRCm39) missense probably benign 0.35
R2089:Or10g9 UTSW 9 39,912,500 (GRCm39) missense probably benign 0.01
R2091:Or10g9 UTSW 9 39,912,500 (GRCm39) missense probably benign 0.01
R2091:Or10g9 UTSW 9 39,912,500 (GRCm39) missense probably benign 0.01
R2179:Or10g9 UTSW 9 39,912,220 (GRCm39) missense probably benign 0.44
R3424:Or10g9 UTSW 9 39,911,830 (GRCm39) missense probably damaging 0.97
R3964:Or10g9 UTSW 9 39,911,767 (GRCm39) missense possibly damaging 0.95
R3965:Or10g9 UTSW 9 39,911,767 (GRCm39) missense possibly damaging 0.95
R4111:Or10g9 UTSW 9 39,912,194 (GRCm39) nonsense probably null
R4537:Or10g9 UTSW 9 39,911,616 (GRCm39) missense probably benign 0.01
R4737:Or10g9 UTSW 9 39,911,718 (GRCm39) missense probably damaging 0.96
R4926:Or10g9 UTSW 9 39,912,319 (GRCm39) splice site probably null
R5587:Or10g9 UTSW 9 39,911,917 (GRCm39) missense possibly damaging 0.90
R6387:Or10g9 UTSW 9 39,912,148 (GRCm39) missense probably damaging 0.99
R6394:Or10g9 UTSW 9 39,912,001 (GRCm39) missense probably benign 0.04
R6765:Or10g9 UTSW 9 39,912,493 (GRCm39) missense probably damaging 1.00
R7312:Or10g9 UTSW 9 39,912,106 (GRCm39) missense probably benign 0.22
R7463:Or10g9 UTSW 9 39,911,860 (GRCm39) missense probably benign 0.07
R7486:Or10g9 UTSW 9 39,912,181 (GRCm39) missense probably benign 0.39
R7581:Or10g9 UTSW 9 39,911,718 (GRCm39) missense probably damaging 0.96
R8364:Or10g9 UTSW 9 39,911,660 (GRCm39) missense probably benign 0.22
R8414:Or10g9 UTSW 9 39,912,241 (GRCm39) missense probably benign 0.19
R9049:Or10g9 UTSW 9 39,911,919 (GRCm39) missense possibly damaging 0.56
R9567:Or10g9 UTSW 9 39,912,367 (GRCm39) missense possibly damaging 0.95
R9632:Or10g9 UTSW 9 39,912,172 (GRCm39) missense probably damaging 1.00
R9710:Or10g9 UTSW 9 39,912,172 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGGTGTACACAACAGGG -3'
(R):5'- GCTGTCCAGACTACATTGACC -3'

Sequencing Primer
(F):5'- TTGAGTAGGGGTGTCAACAC -3'
(R):5'- GTCCAGACTACATTGACCTTCCG -3'
Posted On 2016-07-22