Incidental Mutation 'R5303:Syne1'
ID 404360
Institutional Source Beutler Lab
Gene Symbol Syne1
Ensembl Gene ENSMUSG00000096054
Gene Name spectrin repeat containing, nuclear envelope 1
Synonyms C130039F11Rik, enaptin165, SYNE-1, nesprin-1, A330049M09Rik
MMRRC Submission 042886-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5303 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 4970917-5501482 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 5370464 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 232 (T232A)
Ref Sequence ENSEMBL: ENSMUSP00000149011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041639] [ENSMUST00000214945] [ENSMUST00000215295]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000041639
AA Change: T239A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000039440
Gene: ENSMUSG00000096054
AA Change: T239A

DomainStartEndE-ValueType
CH 29 139 4.55e-14 SMART
low complexity region 145 167 N/A INTRINSIC
CH 187 285 9.67e-18 SMART
coiled coil region 425 452 N/A INTRINSIC
Blast:SPEC 493 599 2e-28 BLAST
Blast:SPEC 606 695 7e-40 BLAST
Blast:SPEC 701 815 1e-32 BLAST
Blast:SPEC 815 913 4e-41 BLAST
Blast:SPEC 920 1013 9e-53 BLAST
Blast:SPEC 1117 1219 2e-60 BLAST
coiled coil region 1267 1329 N/A INTRINSIC
low complexity region 1349 1368 N/A INTRINSIC
coiled coil region 1399 1427 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214945
AA Change: T232A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000215295
AA Change: T239A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a spectrin repeat containing protein expressed in skeletal and smooth muscle, and peripheral blood lymphocytes, that localizes to the nuclear membrane. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia 8, also referred to as autosomal recessive cerebellar ataxia type 1 or recessive ataxia of Beauce. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an allele lacking the KASH domain exhibit neonatal and postnatal lethality, progressive muscular dystrophy, and limb weakness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,199,999 (GRCm39) G531A probably damaging Het
4921504E06Rik A G 2: 19,521,110 (GRCm39) Y256H possibly damaging Het
Abcc12 C A 8: 87,236,415 (GRCm39) R1133L probably benign Het
Acss3 T A 10: 106,920,712 (GRCm39) T133S possibly damaging Het
Adra1d G A 2: 131,388,169 (GRCm39) P462L possibly damaging Het
Ank2 A T 3: 126,739,453 (GRCm39) probably benign Het
Arid2 G A 15: 96,290,349 (GRCm39) R1748Q probably damaging Het
B3glct C T 5: 149,677,488 (GRCm39) probably benign Het
C3ar1 A T 6: 122,826,794 (GRCm39) S474R probably damaging Het
Cd1d1 A G 3: 86,905,427 (GRCm39) F189L probably benign Het
Cd46 T C 1: 194,744,707 (GRCm39) I344V probably benign Het
Chrna1 T C 2: 73,396,618 (GRCm39) M426V probably benign Het
Cinp G A 12: 110,843,295 (GRCm39) T139M probably damaging Het
Cplane1 G A 15: 8,290,174 (GRCm39) probably null Het
Disp2 T C 2: 118,641,329 (GRCm39) probably benign Het
Dnaaf6rt G A 1: 31,262,537 (GRCm39) R173H probably damaging Het
Eapp G A 12: 54,739,703 (GRCm39) P38L probably damaging Het
Eif4g3 T C 4: 137,853,873 (GRCm39) S480P probably benign Het
Epb41l3 G C 17: 69,564,444 (GRCm39) E390Q probably damaging Het
Fermt1 T C 2: 132,753,259 (GRCm39) probably null Het
Foxf2 T A 13: 31,810,463 (GRCm39) F134Y possibly damaging Het
Foxp2 T A 6: 15,324,636 (GRCm39) C95S probably benign Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
Gria1 A G 11: 57,133,851 (GRCm39) T577A probably benign Het
Hal A G 10: 93,352,227 (GRCm39) probably benign Het
Hdac7 C A 15: 97,695,899 (GRCm39) E670D probably damaging Het
Islr2 A T 9: 58,115,558 (GRCm39) probably benign Het
Itpr3 T C 17: 27,335,663 (GRCm39) Y2258H probably benign Het
Mical3 G T 6: 120,936,941 (GRCm39) T1195K probably benign Het
Myh1 T C 11: 67,092,843 (GRCm39) S46P probably benign Het
Mylk3 T A 8: 86,077,105 (GRCm39) I444F probably damaging Het
Nlrc3 A T 16: 3,781,478 (GRCm39) C644S probably benign Het
Notch1 C T 2: 26,368,631 (GRCm39) V553M probably benign Het
Or10g9 A G 9: 39,911,884 (GRCm39) I213T probably damaging Het
Or4a72 T A 2: 89,405,345 (GRCm39) I242F possibly damaging Het
Or51a43 T C 7: 103,718,239 (GRCm39) probably benign Het
Or5b102 T A 19: 13,041,139 (GRCm39) Y121* probably null Het
Postn A G 3: 54,285,018 (GRCm39) T669A probably damaging Het
Ppp5c G T 7: 16,739,209 (GRCm39) Q472K probably benign Het
Qsox1 T C 1: 155,655,039 (GRCm39) H708R probably benign Het
Rhbdl2 A G 4: 123,704,014 (GRCm39) probably benign Het
Ryr1 C T 7: 28,767,907 (GRCm39) E2884K probably damaging Het
Saysd1 T C 14: 20,133,026 (GRCm39) T44A probably benign Het
Septin14 T A 5: 129,766,712 (GRCm39) M290L possibly damaging Het
Sh3bp5 C A 14: 31,099,452 (GRCm39) R265L probably benign Het
Slc38a8 C A 8: 120,212,780 (GRCm39) V294L possibly damaging Het
Spdye4b C T 5: 143,188,158 (GRCm39) T217I probably benign Het
Sugp2 T A 8: 70,694,827 (GRCm39) probably benign Het
Tbc1d5 A T 17: 51,043,228 (GRCm39) D753E probably benign Het
Tmed1 G T 9: 21,421,343 (GRCm39) Q44K possibly damaging Het
Ttc6 T A 12: 57,622,606 (GRCm39) S2T possibly damaging Het
Ube4b T C 4: 149,468,260 (GRCm39) D172G probably damaging Het
Vmn1r235 C A 17: 21,482,268 (GRCm39) Q198K probably benign Het
Wdfy3 T C 5: 102,100,849 (GRCm39) H256R probably damaging Het
Zfat A T 15: 67,982,335 (GRCm39) H1059Q probably damaging Het
Zfp758 A G 17: 22,593,842 (GRCm39) I77M probably benign Het
Zfp850 C T 7: 27,707,838 (GRCm39) A2T probably damaging Het
Zfyve1 A T 12: 83,621,830 (GRCm39) N188K probably damaging Het
Zyg11a C T 4: 108,041,629 (GRCm39) probably null Het
Other mutations in Syne1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Syne1 APN 10 5,342,167 (GRCm38) synonymous probably benign
IGL00725:Syne1 APN 10 5,344,922 (GRCm38) missense possibly damaging 0.48
IGL00799:Syne1 APN 10 5,347,878 (GRCm38) missense probably benign 0.00
IGL01087:Syne1 APN 10 5,375,708 (GRCm39) missense probably damaging 1.00
IGL01123:Syne1 APN 10 5,294,921 (GRCm39) nonsense probably null
IGL01147:Syne1 APN 10 5,002,691 (GRCm39) nonsense probably null
IGL01150:Syne1 APN 10 5,393,154 (GRCm39) missense probably damaging 1.00
IGL01154:Syne1 APN 10 5,310,848 (GRCm39) missense probably damaging 1.00
IGL01727:Syne1 APN 10 4,997,842 (GRCm39) missense probably damaging 0.99
IGL01761:Syne1 APN 10 5,355,456 (GRCm39) missense probably damaging 1.00
IGL01793:Syne1 APN 10 5,302,191 (GRCm39) missense possibly damaging 0.67
IGL01961:Syne1 APN 10 4,993,723 (GRCm39) missense possibly damaging 0.94
IGL01975:Syne1 APN 10 5,018,908 (GRCm39) intron probably benign
IGL02152:Syne1 APN 10 5,374,382 (GRCm39) missense probably damaging 1.00
IGL02423:Syne1 APN 10 5,318,295 (GRCm39) missense probably benign 0.00
IGL02457:Syne1 APN 10 5,292,167 (GRCm39) missense probably damaging 1.00
IGL02543:Syne1 APN 10 4,993,618 (GRCm39) missense probably damaging 0.97
IGL02836:Syne1 APN 10 5,359,875 (GRCm39) splice site probably benign
IGL03141:Syne1 APN 10 5,374,261 (GRCm39) missense probably damaging 1.00
FR4548:Syne1 UTSW 10 4,982,969 (GRCm39) missense probably benign 0.09
IGL02799:Syne1 UTSW 10 5,309,059 (GRCm39) missense probably damaging 1.00
PIT4305001:Syne1 UTSW 10 5,283,023 (GRCm39) missense probably damaging 1.00
PIT4687001:Syne1 UTSW 10 5,308,390 (GRCm39) missense possibly damaging 0.87
R0004:Syne1 UTSW 10 5,393,132 (GRCm39) splice site probably benign
R0110:Syne1 UTSW 10 5,317,600 (GRCm39) missense probably damaging 1.00
R0165:Syne1 UTSW 10 4,983,096 (GRCm39) missense probably benign 0.28
R0194:Syne1 UTSW 10 5,374,311 (GRCm39) missense probably benign
R0311:Syne1 UTSW 10 5,298,943 (GRCm39) missense possibly damaging 0.92
R0328:Syne1 UTSW 10 5,298,945 (GRCm39) missense possibly damaging 0.62
R0379:Syne1 UTSW 10 5,491,989 (GRCm39) missense probably damaging 1.00
R0387:Syne1 UTSW 10 5,301,029 (GRCm39) missense probably benign
R0452:Syne1 UTSW 10 5,355,435 (GRCm39) missense probably damaging 0.98
R0456:Syne1 UTSW 10 5,292,252 (GRCm39) missense probably benign 0.04
R0457:Syne1 UTSW 10 4,972,041 (GRCm39) missense probably damaging 1.00
R0469:Syne1 UTSW 10 5,317,600 (GRCm39) missense probably damaging 1.00
R0510:Syne1 UTSW 10 5,317,600 (GRCm39) missense probably damaging 1.00
R0533:Syne1 UTSW 10 5,308,438 (GRCm39) missense probably benign 0.00
R0617:Syne1 UTSW 10 5,300,933 (GRCm39) missense probably damaging 1.00
R0690:Syne1 UTSW 10 4,983,138 (GRCm39) splice site probably benign
R0964:Syne1 UTSW 10 4,993,652 (GRCm39) missense possibly damaging 0.95
R1133:Syne1 UTSW 10 5,299,044 (GRCm39) missense possibly damaging 0.77
R1327:Syne1 UTSW 10 4,998,925 (GRCm39) splice site probably benign
R1339:Syne1 UTSW 10 5,317,571 (GRCm39) missense probably damaging 1.00
R1531:Syne1 UTSW 10 5,297,875 (GRCm39) nonsense probably null
R1558:Syne1 UTSW 10 5,299,280 (GRCm39) nonsense probably null
R1633:Syne1 UTSW 10 5,299,388 (GRCm39) missense probably damaging 1.00
R1642:Syne1 UTSW 10 5,298,694 (GRCm39) missense possibly damaging 0.94
R1658:Syne1 UTSW 10 5,317,616 (GRCm39) missense probably benign 0.03
R1753:Syne1 UTSW 10 5,317,621 (GRCm39) missense probably benign 0.28
R1759:Syne1 UTSW 10 5,299,369 (GRCm39) missense probably damaging 1.00
R1792:Syne1 UTSW 10 4,990,975 (GRCm39) missense probably damaging 1.00
R2076:Syne1 UTSW 10 4,990,897 (GRCm39) missense probably damaging 0.99
R2079:Syne1 UTSW 10 5,311,502 (GRCm39) missense probably benign 0.01
R2102:Syne1 UTSW 10 5,006,514 (GRCm39) missense probably damaging 1.00
R2233:Syne1 UTSW 10 4,991,484 (GRCm39) missense probably benign 0.01
R2305:Syne1 UTSW 10 4,997,573 (GRCm39) missense probably damaging 0.97
R3435:Syne1 UTSW 10 5,298,565 (GRCm39) missense probably damaging 1.00
R3749:Syne1 UTSW 10 5,002,267 (GRCm39) splice site probably benign
R3876:Syne1 UTSW 10 5,002,345 (GRCm39) missense possibly damaging 0.57
R3895:Syne1 UTSW 10 5,355,456 (GRCm39) missense probably damaging 0.98
R3974:Syne1 UTSW 10 4,993,630 (GRCm39) missense probably benign 0.06
R4042:Syne1 UTSW 10 4,991,584 (GRCm39) missense probably benign 0.21
R4120:Syne1 UTSW 10 5,359,798 (GRCm39) missense probably damaging 1.00
R4201:Syne1 UTSW 10 5,297,870 (GRCm39) missense probably benign
R4364:Syne1 UTSW 10 5,303,987 (GRCm39) missense probably damaging 0.96
R4498:Syne1 UTSW 10 4,981,768 (GRCm39) missense probably benign 0.00
R4767:Syne1 UTSW 10 5,294,866 (GRCm39) nonsense probably null
R4804:Syne1 UTSW 10 5,299,310 (GRCm39) missense possibly damaging 0.95
R4917:Syne1 UTSW 10 5,007,909 (GRCm39) missense probably damaging 1.00
R4930:Syne1 UTSW 10 5,002,777 (GRCm39) missense probably damaging 0.99
R5081:Syne1 UTSW 10 4,997,767 (GRCm39) missense probably benign 0.04
R5089:Syne1 UTSW 10 5,355,444 (GRCm39) nonsense probably null
R5174:Syne1 UTSW 10 4,991,490 (GRCm39) missense probably damaging 0.99
R5205:Syne1 UTSW 10 5,002,295 (GRCm39) missense probably benign 0.05
R5384:Syne1 UTSW 10 4,991,494 (GRCm39) missense probably benign 0.00
R5385:Syne1 UTSW 10 4,991,494 (GRCm39) missense probably benign 0.00
R5392:Syne1 UTSW 10 5,298,661 (GRCm39) missense probably damaging 1.00
R5442:Syne1 UTSW 10 5,293,473 (GRCm39) missense probably benign 0.09
R5750:Syne1 UTSW 10 5,289,209 (GRCm39) missense probably benign 0.01
R5935:Syne1 UTSW 10 5,310,706 (GRCm39) splice site probably null
R6015:Syne1 UTSW 10 5,296,819 (GRCm39) critical splice donor site probably null
R6023:Syne1 UTSW 10 5,393,223 (GRCm39) missense probably benign 0.09
R6049:Syne1 UTSW 10 5,297,926 (GRCm39) missense possibly damaging 0.79
R6084:Syne1 UTSW 10 5,298,994 (GRCm39) missense probably damaging 1.00
R6145:Syne1 UTSW 10 5,002,750 (GRCm39) missense probably damaging 1.00
R6164:Syne1 UTSW 10 5,011,429 (GRCm39) missense probably damaging 1.00
R6165:Syne1 UTSW 10 5,375,678 (GRCm39) missense probably damaging 1.00
R6198:Syne1 UTSW 10 5,252,269 (GRCm39) missense probably damaging 0.99
R6217:Syne1 UTSW 10 5,243,761 (GRCm39) missense probably benign 0.00
R6247:Syne1 UTSW 10 5,299,071 (GRCm39) missense probably damaging 0.98
R6271:Syne1 UTSW 10 5,184,652 (GRCm39) missense probably damaging 1.00
R6338:Syne1 UTSW 10 5,205,475 (GRCm39) missense probably benign 0.00
R6344:Syne1 UTSW 10 4,972,212 (GRCm39) missense probably benign 0.08
R6434:Syne1 UTSW 10 5,268,422 (GRCm39) missense probably benign 0.01
R6476:Syne1 UTSW 10 5,104,531 (GRCm39) missense possibly damaging 0.88
R6479:Syne1 UTSW 10 5,406,826 (GRCm39) missense probably damaging 1.00
R6479:Syne1 UTSW 10 5,181,679 (GRCm39) nonsense probably null
R6546:Syne1 UTSW 10 5,168,645 (GRCm39) nonsense probably null
R6578:Syne1 UTSW 10 5,355,454 (GRCm39) nonsense probably null
R6611:Syne1 UTSW 10 4,995,273 (GRCm39) missense probably benign 0.01
R6615:Syne1 UTSW 10 5,251,340 (GRCm39) missense probably damaging 0.98
R6632:Syne1 UTSW 10 5,165,667 (GRCm39) critical splice donor site probably null
R6662:Syne1 UTSW 10 5,078,416 (GRCm39) missense probably damaging 1.00
R6677:Syne1 UTSW 10 4,990,942 (GRCm39) missense possibly damaging 0.82
R6764:Syne1 UTSW 10 5,179,011 (GRCm39) nonsense probably null
R6765:Syne1 UTSW 10 5,093,285 (GRCm39) splice site probably null
R6778:Syne1 UTSW 10 5,052,406 (GRCm39) missense probably damaging 0.97
R6851:Syne1 UTSW 10 5,212,703 (GRCm39) nonsense probably null
R6878:Syne1 UTSW 10 5,370,388 (GRCm39) missense possibly damaging 0.78
R6883:Syne1 UTSW 10 5,181,704 (GRCm39) nonsense probably null
R6910:Syne1 UTSW 10 4,998,887 (GRCm39) missense probably benign 0.01
R6916:Syne1 UTSW 10 5,177,912 (GRCm39) missense probably benign 0.00
R6925:Syne1 UTSW 10 5,076,682 (GRCm39) missense probably benign 0.00
R6943:Syne1 UTSW 10 5,033,940 (GRCm39) missense probably benign
R6947:Syne1 UTSW 10 5,125,789 (GRCm39) missense probably damaging 1.00
R6965:Syne1 UTSW 10 5,179,120 (GRCm39) missense possibly damaging 0.66
R6968:Syne1 UTSW 10 5,067,041 (GRCm39) missense probably benign 0.09
R7043:Syne1 UTSW 10 5,022,193 (GRCm39) missense possibly damaging 0.77
R7059:Syne1 UTSW 10 5,296,859 (GRCm39) missense probably damaging 1.00
R7067:Syne1 UTSW 10 5,184,586 (GRCm39) missense probably damaging 1.00
R7087:Syne1 UTSW 10 5,492,024 (GRCm39) start gained probably benign
R7099:Syne1 UTSW 10 5,073,744 (GRCm39) missense probably benign 0.43
R7107:Syne1 UTSW 10 5,082,078 (GRCm39) missense probably damaging 1.00
R7120:Syne1 UTSW 10 5,243,971 (GRCm39) missense probably benign
R7127:Syne1 UTSW 10 5,193,180 (GRCm39) missense probably damaging 1.00
R7128:Syne1 UTSW 10 5,193,180 (GRCm39) missense probably damaging 1.00
R7131:Syne1 UTSW 10 5,178,221 (GRCm39) missense probably damaging 1.00
R7132:Syne1 UTSW 10 5,193,180 (GRCm39) missense probably damaging 1.00
R7133:Syne1 UTSW 10 5,181,592 (GRCm39) missense probably damaging 1.00
R7135:Syne1 UTSW 10 5,183,409 (GRCm39) missense probably benign 0.01
R7147:Syne1 UTSW 10 5,199,340 (GRCm39) missense probably damaging 1.00
R7158:Syne1 UTSW 10 5,007,931 (GRCm39) missense probably damaging 1.00
R7189:Syne1 UTSW 10 5,374,295 (GRCm39) missense probably benign 0.03
R7193:Syne1 UTSW 10 5,183,406 (GRCm39) missense probably damaging 1.00
R7194:Syne1 UTSW 10 5,060,859 (GRCm39) missense probably damaging 1.00
R7233:Syne1 UTSW 10 5,252,160 (GRCm39) missense probably damaging 1.00
R7255:Syne1 UTSW 10 5,283,446 (GRCm39) missense probably damaging 0.98
R7267:Syne1 UTSW 10 5,178,218 (GRCm39) missense probably damaging 1.00
R7294:Syne1 UTSW 10 5,047,483 (GRCm39) critical splice donor site probably null
R7303:Syne1 UTSW 10 5,206,805 (GRCm39) missense probably benign 0.04
R7313:Syne1 UTSW 10 4,997,635 (GRCm39) missense probably damaging 1.00
R7330:Syne1 UTSW 10 5,078,434 (GRCm39) missense probably benign 0.00
R7334:Syne1 UTSW 10 5,007,886 (GRCm39) missense probably damaging 1.00
R7363:Syne1 UTSW 10 5,090,970 (GRCm39) missense possibly damaging 0.45
R7400:Syne1 UTSW 10 5,168,580 (GRCm39) missense probably benign 0.12
R7425:Syne1 UTSW 10 5,375,760 (GRCm39) missense probably damaging 1.00
R7427:Syne1 UTSW 10 5,223,718 (GRCm39) missense probably damaging 0.98
R7446:Syne1 UTSW 10 5,172,266 (GRCm39) missense probably benign 0.00
R7462:Syne1 UTSW 10 5,002,793 (GRCm39) missense possibly damaging 0.87
R7502:Syne1 UTSW 10 5,283,446 (GRCm39) missense probably damaging 0.98
R7525:Syne1 UTSW 10 5,135,559 (GRCm39) critical splice acceptor site probably null
R7529:Syne1 UTSW 10 5,374,382 (GRCm39) missense probably damaging 1.00
R7577:Syne1 UTSW 10 5,074,820 (GRCm39) missense probably damaging 1.00
R7579:Syne1 UTSW 10 5,299,324 (GRCm39) missense probably damaging 1.00
R7594:Syne1 UTSW 10 5,165,190 (GRCm39) critical splice donor site probably null
R7646:Syne1 UTSW 10 5,122,949 (GRCm39) missense probably damaging 1.00
R7651:Syne1 UTSW 10 5,293,416 (GRCm39) missense probably damaging 1.00
R7651:Syne1 UTSW 10 5,155,074 (GRCm39) missense probably benign 0.38
R7669:Syne1 UTSW 10 5,011,531 (GRCm39) missense probably damaging 1.00
R7672:Syne1 UTSW 10 5,168,527 (GRCm39) missense probably benign 0.02
R7682:Syne1 UTSW 10 5,112,461 (GRCm39) missense probably benign
R7702:Syne1 UTSW 10 5,195,835 (GRCm39) missense probably damaging 1.00
R7767:Syne1 UTSW 10 5,283,632 (GRCm39) missense possibly damaging 0.49
R7767:Syne1 UTSW 10 5,283,560 (GRCm39) missense possibly damaging 0.60
R7829:Syne1 UTSW 10 5,292,293 (GRCm39) missense probably damaging 0.96
R7840:Syne1 UTSW 10 5,082,078 (GRCm39) missense probably damaging 1.00
R7859:Syne1 UTSW 10 5,107,683 (GRCm39) missense possibly damaging 0.80
R7899:Syne1 UTSW 10 5,177,956 (GRCm39) nonsense probably null
R7918:Syne1 UTSW 10 5,309,078 (GRCm39) missense possibly damaging 0.50
R7923:Syne1 UTSW 10 5,214,738 (GRCm39) missense probably damaging 1.00
R7946:Syne1 UTSW 10 5,200,919 (GRCm39) missense possibly damaging 0.92
R7966:Syne1 UTSW 10 5,066,965 (GRCm39) critical splice donor site probably null
R7975:Syne1 UTSW 10 4,981,786 (GRCm39) missense probably benign 0.00
R7981:Syne1 UTSW 10 5,179,248 (GRCm39) missense probably benign 0.04
R8053:Syne1 UTSW 10 5,002,658 (GRCm39) nonsense probably null
R8054:Syne1 UTSW 10 5,220,970 (GRCm39) missense probably benign 0.22
R8062:Syne1 UTSW 10 5,135,394 (GRCm39) critical splice donor site probably null
R8085:Syne1 UTSW 10 5,178,021 (GRCm39) missense possibly damaging 0.78
R8087:Syne1 UTSW 10 5,283,034 (GRCm39) missense probably benign
R8094:Syne1 UTSW 10 5,067,031 (GRCm39) missense probably damaging 0.98
R8310:Syne1 UTSW 10 5,297,829 (GRCm39) missense probably benign
R8325:Syne1 UTSW 10 5,096,257 (GRCm39) missense probably benign 0.15
R8342:Syne1 UTSW 10 5,058,622 (GRCm39) missense probably benign 0.18
R8353:Syne1 UTSW 10 5,300,983 (GRCm39) missense probably damaging 1.00
R8376:Syne1 UTSW 10 4,993,615 (GRCm39) missense probably benign 0.09
R8398:Syne1 UTSW 10 5,074,923 (GRCm39) missense probably damaging 1.00
R8434:Syne1 UTSW 10 5,073,057 (GRCm39) missense probably benign 0.00
R8436:Syne1 UTSW 10 5,178,659 (GRCm39) missense probably benign 0.26
R8459:Syne1 UTSW 10 5,374,277 (GRCm39) nonsense probably null
R8461:Syne1 UTSW 10 5,011,463 (GRCm39) missense probably benign 0.34
R8496:Syne1 UTSW 10 5,268,441 (GRCm39) missense probably damaging 0.99
R8496:Syne1 UTSW 10 5,178,896 (GRCm39) missense probably damaging 0.99
R8693:Syne1 UTSW 10 5,090,928 (GRCm39) missense possibly damaging 0.60
R8698:Syne1 UTSW 10 5,179,229 (GRCm39) missense probably damaging 1.00
R8701:Syne1 UTSW 10 5,155,026 (GRCm39) nonsense probably null
R8713:Syne1 UTSW 10 5,266,040 (GRCm39) missense probably damaging 1.00
R8724:Syne1 UTSW 10 5,033,861 (GRCm39) missense possibly damaging 0.77
R8729:Syne1 UTSW 10 5,179,275 (GRCm39) missense probably benign 0.00
R8742:Syne1 UTSW 10 5,058,661 (GRCm39) missense probably benign 0.09
R8757:Syne1 UTSW 10 5,144,618 (GRCm39) missense probably damaging 1.00
R8776:Syne1 UTSW 10 5,181,783 (GRCm39) missense possibly damaging 0.81
R8776-TAIL:Syne1 UTSW 10 5,181,783 (GRCm39) missense possibly damaging 0.81
R8778:Syne1 UTSW 10 5,309,066 (GRCm39) missense probably benign 0.00
R8801:Syne1 UTSW 10 5,308,335 (GRCm39) missense probably damaging 1.00
R8803:Syne1 UTSW 10 5,311,535 (GRCm39) missense probably damaging 1.00
R8808:Syne1 UTSW 10 5,309,074 (GRCm39) missense probably damaging 1.00
R8829:Syne1 UTSW 10 5,058,685 (GRCm39) missense probably benign
R8843:Syne1 UTSW 10 5,143,040 (GRCm39) missense possibly damaging 0.88
R8843:Syne1 UTSW 10 5,280,204 (GRCm39) missense probably benign 0.01
R8854:Syne1 UTSW 10 5,078,503 (GRCm39) missense probably benign 0.00
R8863:Syne1 UTSW 10 5,049,527 (GRCm39) missense probably damaging 1.00
R8864:Syne1 UTSW 10 5,370,473 (GRCm39) missense probably benign 0.01
R8881:Syne1 UTSW 10 5,223,639 (GRCm39) missense probably damaging 1.00
R8884:Syne1 UTSW 10 5,181,822 (GRCm39) missense possibly damaging 0.93
R8893:Syne1 UTSW 10 5,299,020 (GRCm39) nonsense probably null
R8958:Syne1 UTSW 10 5,181,768 (GRCm39) missense probably benign
R8964:Syne1 UTSW 10 5,060,872 (GRCm39) missense
R8975:Syne1 UTSW 10 5,161,945 (GRCm39) missense probably benign 0.04
R8987:Syne1 UTSW 10 5,177,579 (GRCm39) missense possibly damaging 0.92
R8992:Syne1 UTSW 10 5,135,508 (GRCm39) missense probably benign 0.01
R9005:Syne1 UTSW 10 5,155,406 (GRCm39) missense probably benign
R9084:Syne1 UTSW 10 5,289,240 (GRCm39) missense probably benign 0.01
R9117:Syne1 UTSW 10 5,053,667 (GRCm39) missense probably damaging 0.96
R9128:Syne1 UTSW 10 5,058,556 (GRCm39) missense probably benign 0.38
R9181:Syne1 UTSW 10 5,063,994 (GRCm39) missense probably damaging 0.99
R9189:Syne1 UTSW 10 5,172,289 (GRCm39) missense probably benign 0.00
R9189:Syne1 UTSW 10 5,123,008 (GRCm39) missense probably damaging 1.00
R9205:Syne1 UTSW 10 5,152,013 (GRCm39) nonsense probably null
R9217:Syne1 UTSW 10 5,299,324 (GRCm39) missense probably damaging 1.00
R9246:Syne1 UTSW 10 5,255,706 (GRCm39) missense probably benign 0.00
R9264:Syne1 UTSW 10 5,212,793 (GRCm39) missense probably damaging 1.00
R9273:Syne1 UTSW 10 4,990,901 (GRCm39) missense probably benign 0.16
R9315:Syne1 UTSW 10 5,283,553 (GRCm39) missense possibly damaging 0.79
R9331:Syne1 UTSW 10 5,073,666 (GRCm39) missense probably benign 0.45
R9355:Syne1 UTSW 10 5,318,255 (GRCm39) missense probably damaging 1.00
R9378:Syne1 UTSW 10 5,200,954 (GRCm39) missense probably damaging 0.96
R9389:Syne1 UTSW 10 5,179,193 (GRCm39) missense possibly damaging 0.65
R9395:Syne1 UTSW 10 5,261,728 (GRCm39) missense probably damaging 1.00
R9405:Syne1 UTSW 10 5,152,030 (GRCm39) missense probably damaging 1.00
R9417:Syne1 UTSW 10 5,082,021 (GRCm39) missense probably benign
R9419:Syne1 UTSW 10 5,155,071 (GRCm39) missense probably benign 0.01
R9473:Syne1 UTSW 10 5,198,258 (GRCm39) missense probably benign 0.00
R9484:Syne1 UTSW 10 5,170,359 (GRCm39) missense probably damaging 1.00
R9505:Syne1 UTSW 10 4,980,394 (GRCm39) missense probably benign 0.00
R9509:Syne1 UTSW 10 5,298,927 (GRCm39) critical splice donor site probably null
R9546:Syne1 UTSW 10 5,193,123 (GRCm39) missense probably damaging 1.00
R9567:Syne1 UTSW 10 5,196,386 (GRCm39) missense possibly damaging 0.54
R9601:Syne1 UTSW 10 5,209,270 (GRCm39) missense probably benign 0.23
R9619:Syne1 UTSW 10 5,090,909 (GRCm39) missense probably benign 0.03
R9621:Syne1 UTSW 10 5,273,887 (GRCm39) missense probably benign 0.01
R9623:Syne1 UTSW 10 5,152,009 (GRCm39) missense probably damaging 1.00
R9646:Syne1 UTSW 10 5,179,187 (GRCm39) missense possibly damaging 0.95
R9666:Syne1 UTSW 10 4,984,937 (GRCm39) missense probably damaging 1.00
R9677:Syne1 UTSW 10 5,215,125 (GRCm39) missense probably damaging 1.00
R9695:Syne1 UTSW 10 5,268,461 (GRCm39) missense probably benign 0.03
R9696:Syne1 UTSW 10 5,297,847 (GRCm39) missense probably benign 0.00
R9719:Syne1 UTSW 10 5,276,601 (GRCm39) missense possibly damaging 0.47
R9744:Syne1 UTSW 10 5,274,184 (GRCm39) missense probably benign 0.01
R9761:Syne1 UTSW 10 5,318,190 (GRCm39) critical splice donor site probably null
R9763:Syne1 UTSW 10 5,007,858 (GRCm39) missense probably benign 0.31
RF010:Syne1 UTSW 10 5,196,386 (GRCm39) missense possibly damaging 0.89
RF015:Syne1 UTSW 10 5,252,248 (GRCm39) missense probably benign 0.01
RF023:Syne1 UTSW 10 5,205,482 (GRCm39) missense probably damaging 1.00
X0017:Syne1 UTSW 10 5,296,917 (GRCm39) missense probably damaging 1.00
X0025:Syne1 UTSW 10 5,308,973 (GRCm39) nonsense probably null
X0063:Syne1 UTSW 10 5,002,354 (GRCm39) missense probably damaging 1.00
Z1176:Syne1 UTSW 10 5,280,251 (GRCm39) missense probably benign 0.10
Z1176:Syne1 UTSW 10 5,209,280 (GRCm39) missense probably benign
Z1176:Syne1 UTSW 10 5,198,364 (GRCm39) missense probably damaging 0.96
Z1177:Syne1 UTSW 10 5,209,349 (GRCm39) missense probably damaging 1.00
Z1177:Syne1 UTSW 10 5,093,230 (GRCm39) missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- GGCCCTGTTTCTTAATGGGATC -3'
(R):5'- GCACATCTCTGGTTAAAATGACTGG -3'

Sequencing Primer
(F):5'- CTCAAAATTCATGAAATGTGTGGAC -3'
(R):5'- ACCATAAAGTGCTGTGCTAGTG -3'
Posted On 2016-07-22