Incidental Mutation 'R5303:Eapp'
ID404367
Institutional Source Beutler Lab
Gene Symbol Eapp
Ensembl Gene ENSMUSG00000054302
Gene NameE2F-associated phosphoprotein
Synonyms1810011O16Rik, EAPP
MMRRC Submission 042886-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.902) question?
Stock #R5303 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location54670340-54695897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 54692918 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 38 (P38L)
Ref Sequence ENSEMBL: ENSMUSP00000069381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067272] [ENSMUST00000110713] [ENSMUST00000160085] [ENSMUST00000161592] [ENSMUST00000162106] [ENSMUST00000163433]
Predicted Effect probably damaging
Transcript: ENSMUST00000067272
AA Change: P38L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069381
Gene: ENSMUSG00000054302
AA Change: P38L

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110713
AA Change: P38L

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106341
Gene: ENSMUSG00000054302
AA Change: P38L

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 52 68 N/A INTRINSIC
low complexity region 80 97 N/A INTRINSIC
low complexity region 116 125 N/A INTRINSIC
Pfam:Eapp_C 153 241 1.1e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160085
AA Change: P38L

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124699
Gene: ENSMUSG00000054302
AA Change: P38L

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 52 68 N/A INTRINSIC
low complexity region 80 97 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161592
AA Change: P38L

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000123698
Gene: ENSMUSG00000054302
AA Change: P38L

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 52 68 N/A INTRINSIC
low complexity region 80 97 N/A INTRINSIC
low complexity region 116 125 N/A INTRINSIC
Pfam:Eapp_C 136 279 5e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162106
AA Change: P38L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000124232
Gene: ENSMUSG00000054302
AA Change: P38L

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 52 68 N/A INTRINSIC
low complexity region 112 121 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163433
AA Change: P38L

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000130251
Gene: ENSMUSG00000054302
AA Change: P38L

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 52 68 N/A INTRINSIC
low complexity region 80 97 N/A INTRINSIC
low complexity region 116 125 N/A INTRINSIC
Pfam:Eapp_C 136 279 5.8e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179621
Meta Mutation Damage Score 0.0801 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphoprotein that interacts with several members of the E2F family of proteins. The protein localizes to the nucleus, and is present throughout the cell cycle except during mitosis. It functions to modulate E2F-regulated transcription and stimulate proliferation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,406,350 G531A probably damaging Het
2410089E03Rik G A 15: 8,260,690 probably null Het
4921504E06Rik A G 2: 19,516,299 Y256H possibly damaging Het
Abcc12 C A 8: 86,509,786 R1133L probably benign Het
Acss3 T A 10: 107,084,851 T133S possibly damaging Het
Adra1d G A 2: 131,546,249 P462L possibly damaging Het
Ank2 A T 3: 126,945,804 probably benign Het
Arid2 G A 15: 96,392,468 R1748Q probably damaging Het
B3glct C T 5: 149,754,023 probably benign Het
C3ar1 A T 6: 122,849,835 S474R probably damaging Het
Cd1d1 A G 3: 86,998,120 F189L probably benign Het
Cd46 T C 1: 195,062,399 I344V probably benign Het
Chrna1 T C 2: 73,566,274 M426V probably benign Het
Cinp G A 12: 110,876,861 T139M probably damaging Het
Disp2 T C 2: 118,810,848 probably benign Het
Eif4g3 T C 4: 138,126,562 S480P probably benign Het
Epb41l3 G C 17: 69,257,449 E390Q probably damaging Het
Fermt1 T C 2: 132,911,339 probably null Het
Foxf2 T A 13: 31,626,480 F134Y possibly damaging Het
Foxp2 T A 6: 15,324,637 C95S probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gria1 A G 11: 57,243,025 T577A probably benign Het
Hal A G 10: 93,516,365 probably benign Het
Hdac7 C A 15: 97,798,018 E670D probably damaging Het
Islr2 A T 9: 58,208,275 probably benign Het
Itpr3 T C 17: 27,116,689 Y2258H probably benign Het
Mical3 G T 6: 120,959,980 T1195K probably benign Het
Myh1 T C 11: 67,202,017 S46P probably benign Het
Mylk3 T A 8: 85,350,476 I444F probably damaging Het
Nlrc3 A T 16: 3,963,614 C644S probably benign Het
Notch1 C T 2: 26,478,619 V553M probably benign Het
Olfr1245 T A 2: 89,575,001 I242F possibly damaging Het
Olfr1454 T A 19: 13,063,775 Y121* probably null Het
Olfr644 T C 7: 104,069,032 probably benign Het
Olfr979 A G 9: 40,000,588 I213T probably damaging Het
Pih1d3 G A 1: 31,223,456 R173H probably damaging Het
Postn A G 3: 54,377,597 T669A probably damaging Het
Ppp5c G T 7: 17,005,284 Q472K probably benign Het
Qsox1 T C 1: 155,779,293 H708R probably benign Het
Rhbdl2 A G 4: 123,810,221 probably benign Het
Ryr1 C T 7: 29,068,482 E2884K probably damaging Het
Saysd1 T C 14: 20,082,958 T44A probably benign Het
Sept14 T A 5: 129,689,648 M290L possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc38a8 C A 8: 119,486,041 V294L possibly damaging Het
Spdye4b C T 5: 143,202,403 T217I probably benign Het
Sugp2 T A 8: 70,242,177 probably benign Het
Syne1 T C 10: 5,420,464 T232A probably benign Het
Tbc1d5 A T 17: 50,736,200 D753E probably benign Het
Tmed1 G T 9: 21,510,047 Q44K possibly damaging Het
Ttc6 T A 12: 57,575,820 S2T possibly damaging Het
Ube4b T C 4: 149,383,803 D172G probably damaging Het
Vmn1r235 C A 17: 21,262,006 Q198K probably benign Het
Wdfy3 T C 5: 101,952,983 H256R probably damaging Het
Zfat A T 15: 68,110,486 H1059Q probably damaging Het
Zfp758 A G 17: 22,374,861 I77M probably benign Het
Zfp850 C T 7: 28,008,413 A2T probably damaging Het
Zfyve1 A T 12: 83,575,056 N188K probably damaging Het
Zyg11a C T 4: 108,184,432 probably null Het
Other mutations in Eapp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Eapp APN 12 54692808 missense possibly damaging 0.78
IGL01964:Eapp APN 12 54685935 missense probably damaging 0.99
IGL02591:Eapp APN 12 54692822 missense probably damaging 1.00
IGL03323:Eapp APN 12 54673615 missense probably damaging 1.00
IGL03328:Eapp APN 12 54692093 missense probably benign 0.04
R0599:Eapp UTSW 12 54685962 missense probably damaging 1.00
R0939:Eapp UTSW 12 54685949 small deletion probably benign
R1583:Eapp UTSW 12 54685948 nonsense probably null
R1646:Eapp UTSW 12 54685960 nonsense probably null
R1935:Eapp UTSW 12 54673728 missense probably benign 0.01
R1936:Eapp UTSW 12 54673728 missense probably benign 0.01
R5537:Eapp UTSW 12 54692059 missense probably benign 0.22
R7638:Eapp UTSW 12 54673723 missense probably benign 0.02
R8041:Eapp UTSW 12 54692865 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATATCTATGAGAACTAAGCCCAAGC -3'
(R):5'- TAATAGGAGCAGCCCGACAG -3'

Sequencing Primer
(F):5'- CTGACCTGTTCCCAGTGAGGATAAC -3'
(R):5'- TAATAGTGCCACTCCCTGGG -3'
Posted On2016-07-22