Incidental Mutation 'R5303:Foxf2'
ID404371
Institutional Source Beutler Lab
Gene Symbol Foxf2
Ensembl Gene ENSMUSG00000038402
Gene Nameforkhead box F2
SynonymsLUN, FREAC2, Fkh20
MMRRC Submission 042886-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5303 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location31625816-31631403 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31626480 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 134 (F134Y)
Ref Sequence ENSEMBL: ENSMUSP00000046789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042054]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042054
AA Change: F134Y

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000046789
Gene: ENSMUSG00000038402
AA Change: F134Y

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
low complexity region 45 94 N/A INTRINSIC
FH 98 188 6.02e-59 SMART
low complexity region 189 198 N/A INTRINSIC
low complexity region 236 245 N/A INTRINSIC
low complexity region 256 275 N/A INTRINSIC
low complexity region 289 328 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184237
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221561
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221582
Meta Mutation Damage Score 0.2797 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] FOXF2 encodes forkhead box F2, one of many human homologues of the Drosophila melanogaster transcription factor forkhead. FOXF2 is expressed in lung and placenta, and has been shown to transcriptionally activate several lung-specific genes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice do not live through the first day of life due to an inability to suckle, which is secondary to cleft palate and tongue abnormalities. Mice homozygous for an ENU mutation exhibit postnatal lethality without palate defect and abnormal anterior segment dysgenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,406,350 G531A probably damaging Het
2410089E03Rik G A 15: 8,260,690 probably null Het
4921504E06Rik A G 2: 19,516,299 Y256H possibly damaging Het
Abcc12 C A 8: 86,509,786 R1133L probably benign Het
Acss3 T A 10: 107,084,851 T133S possibly damaging Het
Adra1d G A 2: 131,546,249 P462L possibly damaging Het
Ank2 A T 3: 126,945,804 probably benign Het
Arid2 G A 15: 96,392,468 R1748Q probably damaging Het
B3glct C T 5: 149,754,023 probably benign Het
C3ar1 A T 6: 122,849,835 S474R probably damaging Het
Cd1d1 A G 3: 86,998,120 F189L probably benign Het
Cd46 T C 1: 195,062,399 I344V probably benign Het
Chrna1 T C 2: 73,566,274 M426V probably benign Het
Cinp G A 12: 110,876,861 T139M probably damaging Het
Disp2 T C 2: 118,810,848 probably benign Het
Eapp G A 12: 54,692,918 P38L probably damaging Het
Eif4g3 T C 4: 138,126,562 S480P probably benign Het
Epb41l3 G C 17: 69,257,449 E390Q probably damaging Het
Fermt1 T C 2: 132,911,339 probably null Het
Foxp2 T A 6: 15,324,637 C95S probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gria1 A G 11: 57,243,025 T577A probably benign Het
Hal A G 10: 93,516,365 probably benign Het
Hdac7 C A 15: 97,798,018 E670D probably damaging Het
Islr2 A T 9: 58,208,275 probably benign Het
Itpr3 T C 17: 27,116,689 Y2258H probably benign Het
Mical3 G T 6: 120,959,980 T1195K probably benign Het
Myh1 T C 11: 67,202,017 S46P probably benign Het
Mylk3 T A 8: 85,350,476 I444F probably damaging Het
Nlrc3 A T 16: 3,963,614 C644S probably benign Het
Notch1 C T 2: 26,478,619 V553M probably benign Het
Olfr1245 T A 2: 89,575,001 I242F possibly damaging Het
Olfr1454 T A 19: 13,063,775 Y121* probably null Het
Olfr644 T C 7: 104,069,032 probably benign Het
Olfr979 A G 9: 40,000,588 I213T probably damaging Het
Pih1d3 G A 1: 31,223,456 R173H probably damaging Het
Postn A G 3: 54,377,597 T669A probably damaging Het
Ppp5c G T 7: 17,005,284 Q472K probably benign Het
Qsox1 T C 1: 155,779,293 H708R probably benign Het
Rhbdl2 A G 4: 123,810,221 probably benign Het
Ryr1 C T 7: 29,068,482 E2884K probably damaging Het
Saysd1 T C 14: 20,082,958 T44A probably benign Het
Sept14 T A 5: 129,689,648 M290L possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc38a8 C A 8: 119,486,041 V294L possibly damaging Het
Spdye4b C T 5: 143,202,403 T217I probably benign Het
Sugp2 T A 8: 70,242,177 probably benign Het
Syne1 T C 10: 5,420,464 T232A probably benign Het
Tbc1d5 A T 17: 50,736,200 D753E probably benign Het
Tmed1 G T 9: 21,510,047 Q44K possibly damaging Het
Ttc6 T A 12: 57,575,820 S2T possibly damaging Het
Ube4b T C 4: 149,383,803 D172G probably damaging Het
Vmn1r235 C A 17: 21,262,006 Q198K probably benign Het
Wdfy3 T C 5: 101,952,983 H256R probably damaging Het
Zfat A T 15: 68,110,486 H1059Q probably damaging Het
Zfp758 A G 17: 22,374,861 I77M probably benign Het
Zfp850 C T 7: 28,008,413 A2T probably damaging Het
Zfyve1 A T 12: 83,575,056 N188K probably damaging Het
Zyg11a C T 4: 108,184,432 probably null Het
Other mutations in Foxf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Foxf2 APN 13 31626189 missense unknown
IGL01939:Foxf2 APN 13 31626714 missense probably damaging 0.97
IGL02012:Foxf2 APN 13 31626516 missense probably damaging 0.98
IGL02647:Foxf2 APN 13 31627235 missense probably damaging 0.99
IGL03275:Foxf2 APN 13 31626531 missense probably damaging 0.99
R0517:Foxf2 UTSW 13 31626243 missense unknown
R0812:Foxf2 UTSW 13 31627205 missense probably damaging 0.97
R2005:Foxf2 UTSW 13 31626141 missense unknown
R2090:Foxf2 UTSW 13 31626841 missense probably benign 0.23
R3724:Foxf2 UTSW 13 31630530 missense probably damaging 1.00
R4627:Foxf2 UTSW 13 31626888 missense probably benign 0.40
R4757:Foxf2 UTSW 13 31626189 missense unknown
R5049:Foxf2 UTSW 13 31627175 missense probably benign
R5874:Foxf2 UTSW 13 31626792 missense probably benign 0.05
R6983:Foxf2 UTSW 13 31627197 missense probably benign 0.35
R7309:Foxf2 UTSW 13 31626513 missense probably damaging 0.98
R7635:Foxf2 UTSW 13 31626104 missense unknown
R7773:Foxf2 UTSW 13 31627199 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCCCGATTCCCAGATGAGC -3'
(R):5'- TTTGAGAGCCTGGCACTTCC -3'

Sequencing Primer
(F):5'- GATTCCCAGATGAGCACCGAG -3'
(R):5'- CTTCCGCCTGAAGCCGC -3'
Posted On2016-07-22