Incidental Mutation 'R5303:Sh3bp5'
ID 404373
Institutional Source Beutler Lab
Gene Symbol Sh3bp5
Ensembl Gene ENSMUSG00000021892
Gene Name SH3-domain binding protein 5 (BTK-associated)
Synonyms Sab
MMRRC Submission 042886-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.228) question?
Stock # R5303 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 31094571-31158056 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 31099452 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 265 (R265L)
Ref Sequence ENSEMBL: ENSMUSP00000117152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091903] [ENSMUST00000100730] [ENSMUST00000140002]
AlphaFold Q9Z131
Predicted Effect probably benign
Transcript: ENSMUST00000091903
AA Change: R265L

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000089517
Gene: ENSMUSG00000021892
AA Change: R265L

DomainStartEndE-ValueType
Pfam:SH3BP5 42 272 2.2e-99 PFAM
low complexity region 323 335 N/A INTRINSIC
low complexity region 407 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100730
AA Change: R263L

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000098296
Gene: ENSMUSG00000021892
AA Change: R263L

DomainStartEndE-ValueType
Pfam:SH3BP5 60 274 5.5e-95 PFAM
low complexity region 321 333 N/A INTRINSIC
low complexity region 405 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140002
AA Change: R265L

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000117152
Gene: ENSMUSG00000021892
AA Change: R265L

DomainStartEndE-ValueType
Pfam:SH3BP5 42 272 2.3e-99 PFAM
low complexity region 323 335 N/A INTRINSIC
low complexity region 407 428 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147586
Meta Mutation Damage Score 0.2831 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,199,999 (GRCm39) G531A probably damaging Het
4921504E06Rik A G 2: 19,521,110 (GRCm39) Y256H possibly damaging Het
Abcc12 C A 8: 87,236,415 (GRCm39) R1133L probably benign Het
Acss3 T A 10: 106,920,712 (GRCm39) T133S possibly damaging Het
Adra1d G A 2: 131,388,169 (GRCm39) P462L possibly damaging Het
Ank2 A T 3: 126,739,453 (GRCm39) probably benign Het
Arid2 G A 15: 96,290,349 (GRCm39) R1748Q probably damaging Het
B3glct C T 5: 149,677,488 (GRCm39) probably benign Het
C3ar1 A T 6: 122,826,794 (GRCm39) S474R probably damaging Het
Cd1d1 A G 3: 86,905,427 (GRCm39) F189L probably benign Het
Cd46 T C 1: 194,744,707 (GRCm39) I344V probably benign Het
Chrna1 T C 2: 73,396,618 (GRCm39) M426V probably benign Het
Cinp G A 12: 110,843,295 (GRCm39) T139M probably damaging Het
Cplane1 G A 15: 8,290,174 (GRCm39) probably null Het
Disp2 T C 2: 118,641,329 (GRCm39) probably benign Het
Dnaaf6rt G A 1: 31,262,537 (GRCm39) R173H probably damaging Het
Eapp G A 12: 54,739,703 (GRCm39) P38L probably damaging Het
Eif4g3 T C 4: 137,853,873 (GRCm39) S480P probably benign Het
Epb41l3 G C 17: 69,564,444 (GRCm39) E390Q probably damaging Het
Fermt1 T C 2: 132,753,259 (GRCm39) probably null Het
Foxf2 T A 13: 31,810,463 (GRCm39) F134Y possibly damaging Het
Foxp2 T A 6: 15,324,636 (GRCm39) C95S probably benign Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
Gria1 A G 11: 57,133,851 (GRCm39) T577A probably benign Het
Hal A G 10: 93,352,227 (GRCm39) probably benign Het
Hdac7 C A 15: 97,695,899 (GRCm39) E670D probably damaging Het
Islr2 A T 9: 58,115,558 (GRCm39) probably benign Het
Itpr3 T C 17: 27,335,663 (GRCm39) Y2258H probably benign Het
Mical3 G T 6: 120,936,941 (GRCm39) T1195K probably benign Het
Myh1 T C 11: 67,092,843 (GRCm39) S46P probably benign Het
Mylk3 T A 8: 86,077,105 (GRCm39) I444F probably damaging Het
Nlrc3 A T 16: 3,781,478 (GRCm39) C644S probably benign Het
Notch1 C T 2: 26,368,631 (GRCm39) V553M probably benign Het
Or10g9 A G 9: 39,911,884 (GRCm39) I213T probably damaging Het
Or4a72 T A 2: 89,405,345 (GRCm39) I242F possibly damaging Het
Or51a43 T C 7: 103,718,239 (GRCm39) probably benign Het
Or5b102 T A 19: 13,041,139 (GRCm39) Y121* probably null Het
Postn A G 3: 54,285,018 (GRCm39) T669A probably damaging Het
Ppp5c G T 7: 16,739,209 (GRCm39) Q472K probably benign Het
Qsox1 T C 1: 155,655,039 (GRCm39) H708R probably benign Het
Rhbdl2 A G 4: 123,704,014 (GRCm39) probably benign Het
Ryr1 C T 7: 28,767,907 (GRCm39) E2884K probably damaging Het
Saysd1 T C 14: 20,133,026 (GRCm39) T44A probably benign Het
Septin14 T A 5: 129,766,712 (GRCm39) M290L possibly damaging Het
Slc38a8 C A 8: 120,212,780 (GRCm39) V294L possibly damaging Het
Spdye4b C T 5: 143,188,158 (GRCm39) T217I probably benign Het
Sugp2 T A 8: 70,694,827 (GRCm39) probably benign Het
Syne1 T C 10: 5,370,464 (GRCm39) T232A probably benign Het
Tbc1d5 A T 17: 51,043,228 (GRCm39) D753E probably benign Het
Tmed1 G T 9: 21,421,343 (GRCm39) Q44K possibly damaging Het
Ttc6 T A 12: 57,622,606 (GRCm39) S2T possibly damaging Het
Ube4b T C 4: 149,468,260 (GRCm39) D172G probably damaging Het
Vmn1r235 C A 17: 21,482,268 (GRCm39) Q198K probably benign Het
Wdfy3 T C 5: 102,100,849 (GRCm39) H256R probably damaging Het
Zfat A T 15: 67,982,335 (GRCm39) H1059Q probably damaging Het
Zfp758 A G 17: 22,593,842 (GRCm39) I77M probably benign Het
Zfp850 C T 7: 27,707,838 (GRCm39) A2T probably damaging Het
Zfyve1 A T 12: 83,621,830 (GRCm39) N188K probably damaging Het
Zyg11a C T 4: 108,041,629 (GRCm39) probably null Het
Other mutations in Sh3bp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Sh3bp5 APN 14 31,101,347 (GRCm39) nonsense probably null
IGL02828:Sh3bp5 APN 14 31,156,106 (GRCm39) splice site probably benign
R1925:Sh3bp5 UTSW 14 31,157,880 (GRCm39) missense probably benign
R2511:Sh3bp5 UTSW 14 31,133,586 (GRCm39) missense probably damaging 1.00
R4798:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R4799:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R5306:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R5307:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R5308:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R5400:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R5401:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R5402:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R5421:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R5422:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R5496:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R5498:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R5500:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R5687:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R5688:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R5724:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R5762:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R5765:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R5862:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R5938:Sh3bp5 UTSW 14 31,109,791 (GRCm39) missense possibly damaging 0.65
R5940:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R5941:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R6516:Sh3bp5 UTSW 14 31,097,629 (GRCm39) missense possibly damaging 0.84
R6935:Sh3bp5 UTSW 14 31,101,473 (GRCm39) missense probably damaging 0.96
R7309:Sh3bp5 UTSW 14 31,100,246 (GRCm39) missense probably benign 0.21
R8196:Sh3bp5 UTSW 14 31,139,399 (GRCm39) missense probably benign 0.21
R8224:Sh3bp5 UTSW 14 31,099,473 (GRCm39) missense probably damaging 0.97
R8535:Sh3bp5 UTSW 14 31,139,375 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCAAATGAGCACAGCGTCC -3'
(R):5'- TGTTGTAATCATGTGTCACCCC -3'

Sequencing Primer
(F):5'- AGCGTCCCACAATACATGAG -3'
(R):5'- ATGTGTCACCCCCTCCATCAG -3'
Posted On 2016-07-22