Incidental Mutation 'R5303:Nlrc3'
ID404379
Institutional Source Beutler Lab
Gene Symbol Nlrc3
Ensembl Gene ENSMUSG00000049871
Gene NameNLR family, CARD domain containing 3
SynonymsCLR16.2, Caterpiller 16.2, D230007K08Rik
MMRRC Submission 042886-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R5303 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location3945007-3976632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3963614 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 644 (C644S)
Ref Sequence ENSEMBL: ENSMUSP00000155241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177551] [ENSMUST00000180200] [ENSMUST00000229884]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000096308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163478
Predicted Effect probably benign
Transcript: ENSMUST00000177551
AA Change: C660S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000137628
Gene: ENSMUSG00000049871
AA Change: C660S

DomainStartEndE-ValueType
Pfam:NACHT 176 342 2e-34 PFAM
LRR 702 729 3.11e-2 SMART
LRR 730 757 2.27e-4 SMART
LRR 758 785 8.15e-1 SMART
LRR 786 813 2.17e-1 SMART
LRR 814 841 2.12e-4 SMART
LRR 842 869 3.42e0 SMART
LRR 870 897 7.67e-2 SMART
LRR 898 925 3.21e0 SMART
LRR 926 953 1.67e0 SMART
LRR 954 981 4.87e-4 SMART
LRR 982 1009 4.3e0 SMART
LRR 1010 1037 3.8e-6 SMART
LRR 1038 1065 4.47e-3 SMART
LRR 1066 1093 1.08e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180200
SMART Domains Protein: ENSMUSP00000137325
Gene: ENSMUSG00000049871

DomainStartEndE-ValueType
LRR 4 24 8.65e1 SMART
LRR 25 52 2.27e-4 SMART
LRR 53 80 8.15e-1 SMART
LRR 81 108 2.17e-1 SMART
LRR 109 136 2.12e-4 SMART
LRR 137 164 3.42e0 SMART
LRR 165 192 7.67e-2 SMART
LRR 193 220 3.21e0 SMART
LRR 221 248 1.67e0 SMART
LRR 249 276 4.87e-4 SMART
LRR 277 304 4.3e0 SMART
LRR 305 332 3.8e-6 SMART
LRR 333 360 4.47e-3 SMART
LRR 361 388 1.08e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229884
AA Change: C644S

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a NOD-like receptor family member. The encoded protein is a cytosolic regulator of innate immunity. This protein directly interacts with stimulator of interferon genes (STING), to prevent its proper trafficking, resulting in disruption of STING-dependent activation of the innate immune response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced susceptibility to LPS-induced toxic shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,406,350 G531A probably damaging Het
2410089E03Rik G A 15: 8,260,690 probably null Het
4921504E06Rik A G 2: 19,516,299 Y256H possibly damaging Het
Abcc12 C A 8: 86,509,786 R1133L probably benign Het
Acss3 T A 10: 107,084,851 T133S possibly damaging Het
Adra1d G A 2: 131,546,249 P462L possibly damaging Het
Ank2 A T 3: 126,945,804 probably benign Het
Arid2 G A 15: 96,392,468 R1748Q probably damaging Het
B3glct C T 5: 149,754,023 probably benign Het
C3ar1 A T 6: 122,849,835 S474R probably damaging Het
Cd1d1 A G 3: 86,998,120 F189L probably benign Het
Cd46 T C 1: 195,062,399 I344V probably benign Het
Chrna1 T C 2: 73,566,274 M426V probably benign Het
Cinp G A 12: 110,876,861 T139M probably damaging Het
Disp2 T C 2: 118,810,848 probably benign Het
Eapp G A 12: 54,692,918 P38L probably damaging Het
Eif4g3 T C 4: 138,126,562 S480P probably benign Het
Epb41l3 G C 17: 69,257,449 E390Q probably damaging Het
Fermt1 T C 2: 132,911,339 probably null Het
Foxf2 T A 13: 31,626,480 F134Y possibly damaging Het
Foxp2 T A 6: 15,324,637 C95S probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gria1 A G 11: 57,243,025 T577A probably benign Het
Hal A G 10: 93,516,365 probably benign Het
Hdac7 C A 15: 97,798,018 E670D probably damaging Het
Islr2 A T 9: 58,208,275 probably benign Het
Itpr3 T C 17: 27,116,689 Y2258H probably benign Het
Mical3 G T 6: 120,959,980 T1195K probably benign Het
Myh1 T C 11: 67,202,017 S46P probably benign Het
Mylk3 T A 8: 85,350,476 I444F probably damaging Het
Notch1 C T 2: 26,478,619 V553M probably benign Het
Olfr1245 T A 2: 89,575,001 I242F possibly damaging Het
Olfr1454 T A 19: 13,063,775 Y121* probably null Het
Olfr644 T C 7: 104,069,032 probably benign Het
Olfr979 A G 9: 40,000,588 I213T probably damaging Het
Pih1d3 G A 1: 31,223,456 R173H probably damaging Het
Postn A G 3: 54,377,597 T669A probably damaging Het
Ppp5c G T 7: 17,005,284 Q472K probably benign Het
Qsox1 T C 1: 155,779,293 H708R probably benign Het
Rhbdl2 A G 4: 123,810,221 probably benign Het
Ryr1 C T 7: 29,068,482 E2884K probably damaging Het
Saysd1 T C 14: 20,082,958 T44A probably benign Het
Sept14 T A 5: 129,689,648 M290L possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc38a8 C A 8: 119,486,041 V294L possibly damaging Het
Spdye4b C T 5: 143,202,403 T217I probably benign Het
Sugp2 T A 8: 70,242,177 probably benign Het
Syne1 T C 10: 5,420,464 T232A probably benign Het
Tbc1d5 A T 17: 50,736,200 D753E probably benign Het
Tmed1 G T 9: 21,510,047 Q44K possibly damaging Het
Ttc6 T A 12: 57,575,820 S2T possibly damaging Het
Ube4b T C 4: 149,383,803 D172G probably damaging Het
Vmn1r235 C A 17: 21,262,006 Q198K probably benign Het
Wdfy3 T C 5: 101,952,983 H256R probably damaging Het
Zfat A T 15: 68,110,486 H1059Q probably damaging Het
Zfp758 A G 17: 22,374,861 I77M probably benign Het
Zfp850 C T 7: 28,008,413 A2T probably damaging Het
Zfyve1 A T 12: 83,575,056 N188K probably damaging Het
Zyg11a C T 4: 108,184,432 probably null Het
Other mutations in Nlrc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Nlrc3 APN 16 3955166 missense probably damaging 1.00
IGL00943:Nlrc3 APN 16 3965117 missense possibly damaging 0.94
IGL01481:Nlrc3 APN 16 3963905 missense probably damaging 1.00
IGL01517:Nlrc3 APN 16 3947487 missense probably damaging 0.99
IGL01988:Nlrc3 APN 16 3953939 missense probably benign 0.43
IGL02306:Nlrc3 APN 16 3964824 missense probably damaging 1.00
IGL02515:Nlrc3 APN 16 3949459 splice site probably benign
IGL02795:Nlrc3 APN 16 3965285 missense probably damaging 0.99
IGL02897:Nlrc3 APN 16 3964074 missense possibly damaging 0.85
IGL02992:Nlrc3 APN 16 3954023 splice site probably benign
IGL03003:Nlrc3 APN 16 3964862 missense probably benign 0.03
IGL03381:Nlrc3 APN 16 3964315 missense probably benign 0.03
R0064:Nlrc3 UTSW 16 3964087 missense possibly damaging 0.82
R0064:Nlrc3 UTSW 16 3964087 missense possibly damaging 0.82
R0122:Nlrc3 UTSW 16 3958958 missense probably damaging 0.98
R0482:Nlrc3 UTSW 16 3965192 missense possibly damaging 0.81
R0601:Nlrc3 UTSW 16 3948249 splice site probably benign
R0622:Nlrc3 UTSW 16 3953968 missense probably benign 0.04
R0675:Nlrc3 UTSW 16 3948911 missense probably benign 0.01
R1595:Nlrc3 UTSW 16 3965302 missense probably benign 0.03
R1597:Nlrc3 UTSW 16 3963995 missense probably damaging 1.00
R2013:Nlrc3 UTSW 16 3965110 missense probably damaging 1.00
R2077:Nlrc3 UTSW 16 3963992 missense probably benign 0.35
R2327:Nlrc3 UTSW 16 3953440 missense probably damaging 1.00
R2872:Nlrc3 UTSW 16 3957326 missense possibly damaging 0.56
R2872:Nlrc3 UTSW 16 3957326 missense possibly damaging 0.56
R3037:Nlrc3 UTSW 16 3952408 missense probably damaging 1.00
R3794:Nlrc3 UTSW 16 3947875 missense probably benign 0.22
R3843:Nlrc3 UTSW 16 3964964 missense probably benign
R4761:Nlrc3 UTSW 16 3963650 missense probably damaging 1.00
R5375:Nlrc3 UTSW 16 3964753 missense possibly damaging 0.95
R5468:Nlrc3 UTSW 16 3964035 missense probably damaging 1.00
R5719:Nlrc3 UTSW 16 3963725 missense probably damaging 1.00
R5838:Nlrc3 UTSW 16 3953995 missense probably damaging 1.00
R5879:Nlrc3 UTSW 16 3964045 missense probably damaging 1.00
R5942:Nlrc3 UTSW 16 3949429 missense probably damaging 1.00
R6500:Nlrc3 UTSW 16 3952444 missense possibly damaging 0.79
R6600:Nlrc3 UTSW 16 3965074 missense probably benign 0.29
R6704:Nlrc3 UTSW 16 3965081 missense probably damaging 0.99
R7172:Nlrc3 UTSW 16 3963753 missense probably benign 0.30
R7283:Nlrc3 UTSW 16 3947877 missense probably benign 0.25
R7296:Nlrc3 UTSW 16 3963590 missense probably damaging 0.99
R7477:Nlrc3 UTSW 16 3964811 missense probably damaging 0.99
R7817:Nlrc3 UTSW 16 3965463 missense possibly damaging 0.87
R8118:Nlrc3 UTSW 16 3965631 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTGGAACTCTAGCAATCTCAGC -3'
(R):5'- GAGGTCCTACAAGGCTTCCTTC -3'

Sequencing Primer
(F):5'- TAGCAATCTCAGCAGACTACAGGG -3'
(R):5'- TGTGCACGTGCCATCAATG -3'
Posted On2016-07-22