Incidental Mutation 'R0417:Tomm70a'
ID 40438
Institutional Source Beutler Lab
Gene Symbol Tomm70a
Ensembl Gene ENSMUSG00000022752
Gene Name translocase of outer mitochondrial membrane 70A
Synonyms Tomm70a, D16Wsu109e, D16Ium22e, Tom70, 2610044B22Rik, D16Ium22
MMRRC Submission 038619-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.972) question?
Stock # R0417 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 57121703-57156705 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 57149903 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 548 (D548G)
Ref Sequence ENSEMBL: ENSMUSP00000129186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166897]
AlphaFold Q9CZW5
Predicted Effect probably benign
Transcript: ENSMUST00000166897
AA Change: D548G

PolyPhen 2 Score 0.275 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000129186
Gene: ENSMUSG00000022752
AA Change: D548G

DomainStartEndE-ValueType
low complexity region 2 37 N/A INTRINSIC
low complexity region 45 61 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 98 108 N/A INTRINSIC
TPR 117 150 1.04e-7 SMART
TPR 156 189 1.97e-3 SMART
TPR 190 223 1.6e1 SMART
low complexity region 278 291 N/A INTRINSIC
TPR 332 365 1.17e1 SMART
TPR 370 403 3.5e0 SMART
TPR 404 437 3.32e-1 SMART
TPR 445 478 7.49e1 SMART
TPR 479 512 9.39e-1 SMART
TPR 513 547 9.48e1 SMART
TPR 548 581 4.03e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231901
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an import receptor of the outer mitochondrial membrane that is part of the translocase of the outer membrane complex. This protein is involved in the import of mitochondrial precursor proteins. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700027J19Rik A G 7: 4,151,483 (GRCm38) L102P probably damaging Het
1700030K09Rik A G 8: 72,445,400 (GRCm38) K217R probably damaging Het
1810024B03Rik A G 2: 127,186,944 (GRCm38) Y112H probably damaging Het
A430078G23Rik T C 8: 3,388,957 (GRCm38) probably benign Het
Acot2 T C 12: 83,990,613 (GRCm38) Y234H probably benign Het
Alox12e C T 11: 70,321,865 (GRCm38) V53I probably benign Het
Ankrd50 T C 3: 38,456,361 (GRCm38) H619R probably damaging Het
Arfgef3 A T 10: 18,603,511 (GRCm38) L1452Q probably damaging Het
Arhgap42 T C 9: 9,180,033 (GRCm38) S82G possibly damaging Het
Bicra C A 7: 15,972,322 (GRCm38) R1398L probably damaging Het
Boc T C 16: 44,520,234 (GRCm38) T118A probably benign Het
Btnl9 A G 11: 49,175,595 (GRCm38) Y381H probably damaging Het
Cbln3 T G 14: 55,884,129 (GRCm38) E20A probably benign Het
Csrnp3 A G 2: 66,019,543 (GRCm38) Y171C probably benign Het
Cyp2d9 A T 15: 82,455,951 (GRCm38) I181F probably damaging Het
Cyp7b1 T A 3: 18,096,691 (GRCm38) T295S probably damaging Het
Dbn1 C T 13: 55,474,916 (GRCm38) E585K probably damaging Het
Dok1 A T 6: 83,031,569 (GRCm38) D377E probably damaging Het
Eed A T 7: 89,971,552 (GRCm38) Y87* probably null Het
Entpd3 T C 9: 120,557,421 (GRCm38) V156A probably damaging Het
Exo5 T A 4: 120,922,072 (GRCm38) T199S probably damaging Het
Extl2 T C 3: 116,024,357 (GRCm38) I106T probably benign Het
Ezh2 A G 6: 47,551,726 (GRCm38) C291R probably benign Het
Flvcr1 A T 1: 191,011,219 (GRCm38) M466K probably benign Het
Fras1 G T 5: 96,691,372 (GRCm38) M1583I probably benign Het
Fzd9 G T 5: 135,249,619 (GRCm38) R471S probably damaging Het
Galr1 A T 18: 82,405,540 (GRCm38) F204Y probably damaging Het
Gm38394 A T 1: 133,658,538 (GRCm38) S354T probably benign Het
Gna11 A T 10: 81,530,904 (GRCm38) I324N probably damaging Het
Gucy1a2 A G 9: 3,759,484 (GRCm38) E430G possibly damaging Het
Hhatl C T 9: 121,788,762 (GRCm38) A254T probably benign Het
Ikzf1 A C 11: 11,769,352 (GRCm38) N353T probably benign Het
Il7 T A 3: 7,576,027 (GRCm38) T110S probably damaging Het
Keg1 A G 19: 12,711,060 (GRCm38) N53D probably damaging Het
Klhl21 T C 4: 152,015,507 (GRCm38) I558T probably damaging Het
Lca5l G A 16: 96,162,653 (GRCm38) T357M probably damaging Het
Lrba T C 3: 86,715,654 (GRCm38) S2448P probably damaging Het
Map3k6 T A 4: 133,248,082 (GRCm38) Y709* probably null Het
Megf6 A G 4: 154,267,967 (GRCm38) E1261G probably benign Het
Mettl3 C T 14: 52,296,698 (GRCm38) G473D probably damaging Het
Mga A G 2: 119,902,790 (GRCm38) I40V probably damaging Het
Mmp13 T A 9: 7,276,602 (GRCm38) D232E probably benign Het
Nampt T C 12: 32,833,101 (GRCm38) V95A probably benign Het
Nbeal1 T C 1: 60,247,734 (GRCm38) V905A probably benign Het
Nomo1 A T 7: 46,068,698 (GRCm38) E840V possibly damaging Het
Nprl2 A T 9: 107,543,298 (GRCm38) I101F probably damaging Het
Nup160 A T 2: 90,735,427 (GRCm38) I1378F possibly damaging Het
Ogdhl T C 14: 32,326,979 (GRCm38) S69P probably damaging Het
Olfr1105 A T 2: 87,033,445 (GRCm38) Y259N probably damaging Het
Olfr1240 C A 2: 89,440,175 (GRCm38) V35L possibly damaging Het
Olfr1283 A G 2: 111,369,105 (GRCm38) S158G possibly damaging Het
Olfr1390 T A 11: 49,340,673 (GRCm38) I47N possibly damaging Het
Olfr143 T C 9: 38,253,864 (GRCm38) F149S probably benign Het
Olfr870 G A 9: 20,171,214 (GRCm38) A119V probably damaging Het
Olfr894 A G 9: 38,219,455 (GRCm38) I211V probably benign Het
Osbpl3 C T 6: 50,348,018 (GRCm38) V167I probably benign Het
Pclo T A 5: 14,713,022 (GRCm38) H3836Q unknown Het
Prkcg A T 7: 3,304,304 (GRCm38) probably null Het
Ror1 A T 4: 100,412,000 (GRCm38) H345L possibly damaging Het
Slc36a2 C T 11: 55,181,544 (GRCm38) probably null Het
Slc40a1 G A 1: 45,911,374 (GRCm38) P306L possibly damaging Het
Slc9a8 C A 2: 167,457,344 (GRCm38) T239K probably benign Het
Snapc3 A G 4: 83,450,162 (GRCm38) I299V probably benign Het
Sp3 G A 2: 72,971,501 (GRCm38) A56V possibly damaging Het
Spag17 T A 3: 100,065,554 (GRCm38) S1361T probably benign Het
Sptbn2 A G 19: 4,737,926 (GRCm38) T978A probably benign Het
Stom C A 2: 35,321,632 (GRCm38) V126F probably damaging Het
Stpg2 A G 3: 139,218,321 (GRCm38) T162A probably damaging Het
Stxbp6 G A 12: 44,902,957 (GRCm38) T63M probably damaging Het
Tatdn1 A C 15: 58,921,350 (GRCm38) I69S probably benign Het
Tbata A T 10: 61,180,339 (GRCm38) D198V probably damaging Het
Tbc1d5 T C 17: 50,756,705 (GRCm38) I638V probably benign Het
Ust A G 10: 8,245,936 (GRCm38) F303L probably damaging Het
Vps13d A G 4: 144,976,560 (GRCm38) S4306P probably benign Het
Zfp691 A G 4: 119,170,496 (GRCm38) S180P possibly damaging Het
Other mutations in Tomm70a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00849:Tomm70a APN 16 57,149,810 (GRCm38) splice site probably benign
IGL01064:Tomm70a APN 16 57,152,612 (GRCm38) missense probably damaging 0.99
IGL01597:Tomm70a APN 16 57,133,188 (GRCm38) missense probably benign 0.00
IGL02248:Tomm70a APN 16 57,138,102 (GRCm38) missense probably benign 0.33
IGL02560:Tomm70a APN 16 57,149,849 (GRCm38) missense probably benign 0.33
IGL03328:Tomm70a APN 16 57,144,787 (GRCm38) missense probably damaging 0.99
IGL03335:Tomm70a APN 16 57,149,926 (GRCm38) missense probably damaging 1.00
R0164:Tomm70a UTSW 16 57,147,821 (GRCm38) missense probably damaging 0.96
R0164:Tomm70a UTSW 16 57,147,821 (GRCm38) missense probably damaging 0.96
R0196:Tomm70a UTSW 16 57,146,100 (GRCm38) missense probably benign 0.03
R0763:Tomm70a UTSW 16 57,122,172 (GRCm38) missense probably benign 0.30
R1099:Tomm70a UTSW 16 57,142,817 (GRCm38) missense probably damaging 1.00
R1680:Tomm70a UTSW 16 57,121,961 (GRCm38) missense unknown
R2081:Tomm70a UTSW 16 57,140,758 (GRCm38) missense probably damaging 0.99
R2127:Tomm70a UTSW 16 57,121,871 (GRCm38) missense unknown
R3033:Tomm70a UTSW 16 57,122,025 (GRCm38) missense probably damaging 1.00
R4287:Tomm70a UTSW 16 57,140,622 (GRCm38) missense probably damaging 1.00
R5029:Tomm70a UTSW 16 57,122,151 (GRCm38) missense probably benign
R5210:Tomm70a UTSW 16 57,133,251 (GRCm38) critical splice donor site probably null
R5214:Tomm70a UTSW 16 57,121,937 (GRCm38) missense unknown
R5586:Tomm70a UTSW 16 57,122,130 (GRCm38) missense probably damaging 1.00
R5744:Tomm70a UTSW 16 57,121,839 (GRCm38) start gained probably benign
R5872:Tomm70a UTSW 16 57,144,742 (GRCm38) missense probably benign 0.06
R6256:Tomm70a UTSW 16 57,152,692 (GRCm38) missense probably benign 0.05
R6699:Tomm70a UTSW 16 57,142,802 (GRCm38) missense probably benign 0.02
R6902:Tomm70a UTSW 16 57,138,081 (GRCm38) missense probably damaging 0.96
R7106:Tomm70a UTSW 16 57,140,758 (GRCm38) missense probably damaging 0.99
R7378:Tomm70a UTSW 16 57,146,044 (GRCm38) nonsense probably null
R7817:Tomm70a UTSW 16 57,144,773 (GRCm38) missense probably damaging 1.00
R8002:Tomm70a UTSW 16 57,136,734 (GRCm38) missense probably damaging 0.99
R8214:Tomm70a UTSW 16 57,121,967 (GRCm38) missense unknown
R8862:Tomm70a UTSW 16 57,122,183 (GRCm38) missense probably benign
R9194:Tomm70a UTSW 16 57,152,707 (GRCm38) missense possibly damaging 0.72
R9223:Tomm70a UTSW 16 57,142,803 (GRCm38) missense probably benign 0.00
R9242:Tomm70a UTSW 16 57,138,020 (GRCm38) splice site probably benign
R9338:Tomm70a UTSW 16 57,122,036 (GRCm38) missense probably benign
R9366:Tomm70a UTSW 16 57,149,896 (GRCm38) nonsense probably null
R9649:Tomm70a UTSW 16 57,140,709 (GRCm38) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AAATCAGCCAGTGCCACTAGCATAG -3'
(R):5'- GGGAAGCCTGCATCAAAAGTACAGC -3'

Sequencing Primer
(F):5'- ACCAGAAGCCTTCAGTGTG -3'
(R):5'- CAAAAGTACAGCAAGCTTTAAAACTG -3'
Posted On 2013-05-23