Incidental Mutation 'R5304:Myo3b'
ID 404397
Institutional Source Beutler Lab
Gene Symbol Myo3b
Ensembl Gene ENSMUSG00000042064
Gene Name myosin IIIB
Synonyms A430065P19Rik
MMRRC Submission 042887-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5304 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 70039126-70429198 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 70426888 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 1282 (P1282L)
Ref Sequence ENSEMBL: ENSMUSP00000107862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060208] [ENSMUST00000112243]
AlphaFold Q1EG27
Predicted Effect probably damaging
Transcript: ENSMUST00000060208
AA Change: P1310L

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064
AA Change: P1310L

DomainStartEndE-ValueType
S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112243
AA Change: P1282L

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064
AA Change: P1282L

DomainStartEndE-ValueType
S_TKc 15 281 2.24e-85 SMART
MYSc 325 1047 6.61e-260 SMART
IQ 1047 1069 9.51e1 SMART
IQ 1074 1096 1.73e-5 SMART
low complexity region 1291 1296 N/A INTRINSIC
Meta Mutation Damage Score 0.0632 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A T 9: 22,424,232 (GRCm38) T49S probably benign Het
Adcy1 C T 11: 7,064,198 (GRCm38) A200V probably benign Het
Adgrv1 T C 13: 81,578,253 (GRCm38) D551G possibly damaging Het
Aldh3a2 A G 11: 61,253,712 (GRCm38) V340A probably damaging Het
Amy1 C A 3: 113,558,364 (GRCm38) C393F probably damaging Het
Ankrd16 T C 2: 11,789,734 (GRCm38) V310A probably benign Het
Arhgef15 T C 11: 68,947,237 (GRCm38) S686G probably null Het
Arid4b T A 13: 14,186,929 (GRCm38) N659K probably benign Het
Asz1 C T 6: 18,076,620 (GRCm38) R191Q probably benign Het
Atp2a3 A G 11: 72,988,557 (GRCm38) I947V probably damaging Het
AW011738 G A 4: 156,203,512 (GRCm38) probably benign Het
Bfsp1 G T 2: 143,827,291 (GRCm38) T456K probably benign Het
Cdc25c T C 18: 34,750,811 (GRCm38) T40A possibly damaging Het
Cdh7 G A 1: 110,108,839 (GRCm38) C583Y probably damaging Het
Cfap54 A T 10: 92,821,106 (GRCm38) L3028Q probably damaging Het
Chd1 A T 17: 15,770,268 (GRCm38) H1694L possibly damaging Het
Chd1 A G 17: 15,754,951 (GRCm38) S1088G probably benign Het
Cstf3 G T 2: 104,663,390 (GRCm38) E580* probably null Het
Dip2a A T 10: 76,294,523 (GRCm38) M622K possibly damaging Het
Dlgap1 A T 17: 70,815,207 (GRCm38) H877L probably damaging Het
Egfr G T 11: 16,884,260 (GRCm38) M122I probably benign Het
Etfbkmt T A 6: 149,147,206 (GRCm38) D114E probably damaging Het
Eva1c T C 16: 90,869,663 (GRCm38) L158P probably damaging Het
Exo1 G A 1: 175,892,976 (GRCm38) V287M probably damaging Het
Fam171a1 T C 2: 3,225,617 (GRCm38) Y471H probably damaging Het
Fermt1 T A 2: 132,942,066 (GRCm38) T8S probably benign Het
Fgfr2 G T 7: 130,167,774 (GRCm38) P630T probably damaging Het
Fmo5 G A 3: 97,651,622 (GRCm38) G466E probably damaging Het
Gm5155 A C 7: 17,902,692 (GRCm38) E231D probably benign Het
Hcn4 A G 9: 58,843,932 (GRCm38) I280M probably benign Het
Ifi208 A C 1: 173,683,608 (GRCm38) K443T probably benign Het
Irs3 A G 5: 137,644,741 (GRCm38) F145S probably benign Het
Kirrel T A 3: 87,089,595 (GRCm38) H300L probably benign Het
Krit1 A G 5: 3,819,326 (GRCm38) Q340R probably damaging Het
Lipo5 T C 19: 33,467,749 (GRCm38) D140G unknown Het
Lrrtm4 A T 6: 80,022,700 (GRCm38) Q365L probably benign Het
Lrwd1 G T 5: 136,131,150 (GRCm38) T353K possibly damaging Het
Lsm14a A T 7: 34,353,729 (GRCm38) S240R possibly damaging Het
Map3k5 A G 10: 20,108,238 (GRCm38) I870V probably benign Het
Mmp17 A T 5: 129,594,614 (GRCm38) E76V probably null Het
Mphosph10 A G 7: 64,388,984 (GRCm38) F272L probably damaging Het
Myh10 A G 11: 68,764,245 (GRCm38) K380R probably damaging Het
Nemp2 T C 1: 52,643,079 (GRCm38) probably benign Het
Ola1 T C 2: 73,199,434 (GRCm38) I114V probably damaging Het
Olfr1066 T A 2: 86,455,435 (GRCm38) T279S probably damaging Het
Olfr140 T A 2: 90,051,913 (GRCm38) H137L probably benign Het
Pabpc4 T G 4: 123,290,307 (GRCm38) D204E probably benign Het
Pigr A T 1: 130,849,493 (GRCm38) M679L probably benign Het
Pik3c2b A T 1: 133,070,408 (GRCm38) M341L possibly damaging Het
Plin4 T A 17: 56,106,132 (GRCm38) T498S probably benign Het
Ppp2r5e A G 12: 75,515,685 (GRCm38) S15P possibly damaging Het
Prdm13 T C 4: 21,678,984 (GRCm38) Y502C probably damaging Het
Ptprk T C 10: 28,592,054 (GRCm38) probably null Het
Rapgef6 T C 11: 54,657,374 (GRCm38) S505P probably benign Het
Rgmb G T 17: 15,820,728 (GRCm38) S199* probably null Het
Rgsl1 T C 1: 153,827,492 (GRCm38) T173A probably damaging Het
Rhobtb1 G T 10: 69,269,912 (GRCm38) K102N probably damaging Het
Ripor2 A T 13: 24,674,666 (GRCm38) D147V probably damaging Het
Rsad2 A T 12: 26,450,682 (GRCm38) V202E probably damaging Het
Slc1a6 A G 10: 78,793,307 (GRCm38) N186S probably damaging Het
Soga1 G A 2: 157,023,817 (GRCm38) Q1127* probably null Het
Sorbs3 G A 14: 70,184,896 (GRCm38) R622* probably null Het
Spag9 C A 11: 94,069,012 (GRCm38) D342E probably damaging Het
Srgap3 T C 6: 112,766,939 (GRCm38) Y446C probably damaging Het
Thsd7b C T 1: 129,678,243 (GRCm38) R574* probably null Het
Tmem74 A T 15: 43,866,821 (GRCm38) Y275* probably null Het
Topors A T 4: 40,262,541 (GRCm38) S248T possibly damaging Het
Trpm1 A T 7: 64,208,946 (GRCm38) Y239F probably benign Het
Ttn T A 2: 76,718,183 (GRCm38) Y30179F possibly damaging Het
Ugt2b34 A T 5: 86,892,865 (GRCm38) F399L probably damaging Het
Ush2a A T 1: 188,356,798 (GRCm38) I317F probably damaging Het
Usp1 T C 4: 98,934,618 (GRCm38) V723A probably benign Het
Usp34 T G 11: 23,343,616 (GRCm38) L237V probably damaging Het
Vgf A T 5: 137,032,286 (GRCm38) D434V probably damaging Het
Vmn1r179 A G 7: 23,928,675 (GRCm38) N97S probably benign Het
Vps13a A G 19: 16,710,387 (GRCm38) L899P possibly damaging Het
Vps33b A T 7: 80,274,253 (GRCm38) I41F probably damaging Het
Zap70 A T 1: 36,778,218 (GRCm38) H210L probably damaging Het
Zc3h8 T C 2: 128,928,915 (GRCm38) D300G probably benign Het
Zfp958 C A 8: 4,626,196 (GRCm38) H55N possibly damaging Het
Other mutations in Myo3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Myo3b APN 2 70,105,645 (GRCm38) splice site probably benign
IGL00959:Myo3b APN 2 70,314,292 (GRCm38) missense probably damaging 1.00
IGL01069:Myo3b APN 2 70,245,391 (GRCm38) missense probably benign 0.22
IGL01116:Myo3b APN 2 70,289,386 (GRCm38) missense probably damaging 1.00
IGL02097:Myo3b APN 2 70,238,829 (GRCm38) missense probably damaging 1.00
IGL02220:Myo3b APN 2 70,289,579 (GRCm38) splice site probably benign
IGL02553:Myo3b APN 2 70,095,224 (GRCm38) missense probably benign 0.00
IGL02557:Myo3b APN 2 70,255,319 (GRCm38) missense probably benign 0.16
IGL02648:Myo3b APN 2 70,105,372 (GRCm38) splice site probably benign
IGL02902:Myo3b APN 2 70,289,401 (GRCm38) missense probably benign 0.36
IGL02981:Myo3b APN 2 70,108,625 (GRCm38) missense probably damaging 1.00
IGL03030:Myo3b APN 2 70,426,816 (GRCm38) splice site probably benign
IGL03031:Myo3b APN 2 70,255,377 (GRCm38) missense possibly damaging 0.64
IGL03068:Myo3b APN 2 70,426,816 (GRCm38) splice site probably benign
IGL03078:Myo3b APN 2 70,286,991 (GRCm38) missense probably damaging 1.00
IGL03224:Myo3b APN 2 70,349,939 (GRCm38) missense probably benign
IGL03329:Myo3b APN 2 70,254,459 (GRCm38) missense probably damaging 1.00
R0079:Myo3b UTSW 2 70,095,158 (GRCm38) missense possibly damaging 0.58
R0226:Myo3b UTSW 2 70,217,166 (GRCm38) missense probably benign 0.00
R0238:Myo3b UTSW 2 70,105,425 (GRCm38) missense probably benign 0.00
R0238:Myo3b UTSW 2 70,105,425 (GRCm38) missense probably benign 0.00
R0239:Myo3b UTSW 2 70,105,425 (GRCm38) missense probably benign 0.00
R0239:Myo3b UTSW 2 70,105,425 (GRCm38) missense probably benign 0.00
R0313:Myo3b UTSW 2 70,348,959 (GRCm38) nonsense probably null
R0331:Myo3b UTSW 2 70,095,261 (GRCm38) missense probably damaging 1.00
R0371:Myo3b UTSW 2 70,252,960 (GRCm38) splice site probably benign
R0442:Myo3b UTSW 2 70,238,961 (GRCm38) critical splice donor site probably null
R0964:Myo3b UTSW 2 70,426,849 (GRCm38) missense probably damaging 1.00
R1217:Myo3b UTSW 2 70,330,880 (GRCm38) missense probably benign 0.02
R1429:Myo3b UTSW 2 70,253,007 (GRCm38) missense probably damaging 0.97
R1460:Myo3b UTSW 2 70,232,454 (GRCm38) missense probably benign 0.31
R1617:Myo3b UTSW 2 70,281,218 (GRCm38) missense probably benign 0.00
R1628:Myo3b UTSW 2 70,286,962 (GRCm38) missense probably benign 0.01
R1708:Myo3b UTSW 2 70,245,385 (GRCm38) nonsense probably null
R1940:Myo3b UTSW 2 70,258,075 (GRCm38) missense probably benign 0.01
R2407:Myo3b UTSW 2 70,255,253 (GRCm38) missense probably damaging 1.00
R3081:Myo3b UTSW 2 70,256,583 (GRCm38) splice site probably benign
R3687:Myo3b UTSW 2 70,245,314 (GRCm38) missense probably benign
R3745:Myo3b UTSW 2 70,234,485 (GRCm38) splice site probably benign
R4011:Myo3b UTSW 2 70,096,376 (GRCm38) missense probably benign 0.15
R4074:Myo3b UTSW 2 70,289,464 (GRCm38) missense probably damaging 1.00
R4419:Myo3b UTSW 2 70,096,362 (GRCm38) missense probably damaging 1.00
R4496:Myo3b UTSW 2 70,254,404 (GRCm38) missense probably benign
R4539:Myo3b UTSW 2 70,039,147 (GRCm38) start codon destroyed probably null 0.00
R4643:Myo3b UTSW 2 70,238,842 (GRCm38) missense possibly damaging 0.49
R4657:Myo3b UTSW 2 70,238,899 (GRCm38) missense possibly damaging 0.95
R4807:Myo3b UTSW 2 70,105,712 (GRCm38) missense probably damaging 1.00
R4849:Myo3b UTSW 2 70,244,909 (GRCm38) missense probably damaging 0.98
R4997:Myo3b UTSW 2 70,258,083 (GRCm38) missense possibly damaging 0.49
R5008:Myo3b UTSW 2 70,258,068 (GRCm38) missense probably damaging 0.99
R5070:Myo3b UTSW 2 70,253,112 (GRCm38) missense probably damaging 1.00
R5072:Myo3b UTSW 2 70,095,249 (GRCm38) missense possibly damaging 0.96
R5082:Myo3b UTSW 2 70,258,030 (GRCm38) missense probably benign 0.01
R5103:Myo3b UTSW 2 70,096,403 (GRCm38) missense probably benign 0.08
R5109:Myo3b UTSW 2 70,095,293 (GRCm38) missense possibly damaging 0.66
R5396:Myo3b UTSW 2 70,126,985 (GRCm38) missense probably damaging 0.99
R5400:Myo3b UTSW 2 70,105,380 (GRCm38) missense probably damaging 1.00
R5468:Myo3b UTSW 2 70,234,441 (GRCm38) missense probably benign 0.00
R5620:Myo3b UTSW 2 70,238,910 (GRCm38) missense probably benign 0.04
R5646:Myo3b UTSW 2 70,314,430 (GRCm38) missense probably damaging 0.97
R5729:Myo3b UTSW 2 70,105,739 (GRCm38) missense probably damaging 1.00
R5943:Myo3b UTSW 2 70,286,941 (GRCm38) missense probably benign 0.03
R5971:Myo3b UTSW 2 70,238,899 (GRCm38) missense possibly damaging 0.95
R6091:Myo3b UTSW 2 70,238,769 (GRCm38) missense probably benign 0.00
R6138:Myo3b UTSW 2 70,238,899 (GRCm38) missense possibly damaging 0.95
R6164:Myo3b UTSW 2 70,245,410 (GRCm38) critical splice donor site probably null
R6177:Myo3b UTSW 2 70,313,363 (GRCm38) missense probably benign 0.00
R6421:Myo3b UTSW 2 70,313,356 (GRCm38) missense probably benign 0.02
R6478:Myo3b UTSW 2 70,348,960 (GRCm38) missense probably benign
R6606:Myo3b UTSW 2 70,232,485 (GRCm38) missense possibly damaging 0.94
R6752:Myo3b UTSW 2 70,289,512 (GRCm38) missense probably damaging 1.00
R6982:Myo3b UTSW 2 70,426,065 (GRCm38) missense probably benign 0.02
R6997:Myo3b UTSW 2 70,126,985 (GRCm38) missense probably damaging 0.99
R7032:Myo3b UTSW 2 70,095,264 (GRCm38) missense probably damaging 0.98
R7038:Myo3b UTSW 2 70,095,208 (GRCm38) missense probably benign 0.00
R7062:Myo3b UTSW 2 70,217,157 (GRCm38) missense probably benign 0.00
R7537:Myo3b UTSW 2 70,217,169 (GRCm38) missense probably benign 0.01
R7861:Myo3b UTSW 2 70,108,688 (GRCm38) missense probably damaging 1.00
R7955:Myo3b UTSW 2 70,095,279 (GRCm38) missense probably benign 0.37
R7977:Myo3b UTSW 2 70,330,933 (GRCm38) missense probably benign
R7978:Myo3b UTSW 2 70,253,114 (GRCm38) missense probably damaging 1.00
R7987:Myo3b UTSW 2 70,330,933 (GRCm38) missense probably benign
R8803:Myo3b UTSW 2 70,252,994 (GRCm38) missense probably benign
R8843:Myo3b UTSW 2 70,257,981 (GRCm38) missense probably damaging 1.00
R8896:Myo3b UTSW 2 70,238,816 (GRCm38) missense probably damaging 1.00
R8904:Myo3b UTSW 2 70,426,908 (GRCm38) missense probably benign 0.07
R8909:Myo3b UTSW 2 70,253,096 (GRCm38) missense probably damaging 1.00
R9031:Myo3b UTSW 2 70,251,750 (GRCm38) missense probably damaging 0.99
R9052:Myo3b UTSW 2 70,232,403 (GRCm38) missense probably benign 0.00
R9251:Myo3b UTSW 2 70,258,081 (GRCm38) nonsense probably null
R9268:Myo3b UTSW 2 70,426,961 (GRCm38) makesense probably null
R9334:Myo3b UTSW 2 70,217,016 (GRCm38) missense probably damaging 1.00
R9377:Myo3b UTSW 2 70,238,898 (GRCm38) missense possibly damaging 0.78
R9457:Myo3b UTSW 2 70,095,209 (GRCm38) missense probably benign 0.01
R9520:Myo3b UTSW 2 70,232,409 (GRCm38) missense possibly damaging 0.67
R9593:Myo3b UTSW 2 70,245,304 (GRCm38) missense probably benign 0.43
R9671:Myo3b UTSW 2 70,256,564 (GRCm38) missense probably damaging 1.00
R9790:Myo3b UTSW 2 70,349,943 (GRCm38) missense probably benign 0.35
R9791:Myo3b UTSW 2 70,349,943 (GRCm38) missense probably benign 0.35
U15987:Myo3b UTSW 2 70,238,899 (GRCm38) missense possibly damaging 0.95
X0025:Myo3b UTSW 2 70,232,403 (GRCm38) missense probably benign 0.00
X0065:Myo3b UTSW 2 70,257,969 (GRCm38) missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70,258,027 (GRCm38) missense probably benign 0.01
Z1177:Myo3b UTSW 2 70,096,361 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTAGAGGTAGGGACAGACATTC -3'
(R):5'- GTTCAGCAAGGTTTAGGGCC -3'

Sequencing Primer
(F):5'- CAGACATTCAGAGCTGGGC -3'
(R):5'- CCCAGATTGTGTCCAAAGAAGCTG -3'
Posted On 2016-07-22