Incidental Mutation 'R5304:Usp1'
ID404412
Institutional Source Beutler Lab
Gene Symbol Usp1
Ensembl Gene ENSMUSG00000028560
Gene Nameubiquitin specific peptidase 1
Synonyms
MMRRC Submission 042887-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.905) question?
Stock #R5304 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location98923810-98935543 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98934618 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 723 (V723A)
Ref Sequence ENSEMBL: ENSMUSP00000088917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030286] [ENSMUST00000030289] [ENSMUST00000075836] [ENSMUST00000091358] [ENSMUST00000125104] [ENSMUST00000127417] [ENSMUST00000205650]
Predicted Effect probably benign
Transcript: ENSMUST00000030286
SMART Domains Protein: ENSMUSP00000030286
Gene: ENSMUSG00000028556

DomainStartEndE-ValueType
Pfam:DUF3398 67 159 6.5e-30 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 557 736 1.8e-51 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1135 1163 N/A INTRINSIC
low complexity region 1350 1364 N/A INTRINSIC
low complexity region 1543 1565 N/A INTRINSIC
Pfam:DHR-2 1571 2095 1.4e-217 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030289
AA Change: V723A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030289
Gene: ENSMUSG00000028560
AA Change: V723A

DomainStartEndE-ValueType
Pfam:UCH 80 616 9.2e-35 PFAM
Pfam:UCH_1 415 618 1.3e-11 PFAM
Pfam:UCH 723 781 3.9e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075836
SMART Domains Protein: ENSMUSP00000075233
Gene: ENSMUSG00000028556

DomainStartEndE-ValueType
Pfam:DUF3398 65 159 5.8e-34 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 556 737 3.3e-58 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1105 1133 N/A INTRINSIC
low complexity region 1320 1334 N/A INTRINSIC
low complexity region 1513 1535 N/A INTRINSIC
Pfam:Ded_cyto 1888 2065 6.5e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091358
AA Change: V723A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088917
Gene: ENSMUSG00000028560
AA Change: V723A

DomainStartEndE-ValueType
Pfam:UCH 80 622 5e-39 PFAM
Pfam:UCH_1 346 613 2.8e-11 PFAM
low complexity region 765 779 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124466
Predicted Effect probably benign
Transcript: ENSMUST00000125104
SMART Domains Protein: ENSMUSP00000135496
Gene: ENSMUSG00000028560

DomainStartEndE-ValueType
Pfam:UCH 37 150 4.1e-14 PFAM
Pfam:UCH_1 38 80 1.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127417
SMART Domains Protein: ENSMUSP00000117797
Gene: ENSMUSG00000028556

DomainStartEndE-ValueType
low complexity region 140 162 N/A INTRINSIC
Pfam:Ded_cyto 517 694 3e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205650
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206128
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: This gene encodes a member of the ubiquitin-specific peptidase family. The encoded protein acts as a catalytic subunit in a heterodimeric deubiquitinating enzyme complex that deubiquitinates Fanconi anemia, complementation group D2, and plays a role in homologous recombination-mediated DNA repair. Disruption of this gene is associated with a Fanconi anemia-like phenotype and genomic instability. Alternative splicing results in multiple transcript variants. Pseudogenes of this gene have been defined on chromosomes 3, 12, and 15. [provided by RefSeq, Aug 2014]
PHENOTYPE: Homozygous null mice have a high rate of postnatal lethality related to cyanosis. Male survivors are infertile while female survivors have reduced fertility. Both sexes have reduced number of gametes, are sensitive to ionizing radiation, and have decreased numbers of bone marrow cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A T 9: 22,424,232 T49S probably benign Het
Adcy1 C T 11: 7,064,198 A200V probably benign Het
Adgrv1 T C 13: 81,578,253 D551G possibly damaging Het
Aldh3a2 A G 11: 61,253,712 V340A probably damaging Het
Amy1 C A 3: 113,558,364 C393F probably damaging Het
Ankrd16 T C 2: 11,789,734 V310A probably benign Het
Arhgef15 T C 11: 68,947,237 S686G probably null Het
Arid4b T A 13: 14,186,929 N659K probably benign Het
Asz1 C T 6: 18,076,620 R191Q probably benign Het
Atp2a3 A G 11: 72,988,557 I947V probably damaging Het
AW011738 G A 4: 156,203,512 probably benign Het
Bfsp1 G T 2: 143,827,291 T456K probably benign Het
Cdc25c T C 18: 34,750,811 T40A possibly damaging Het
Cdh7 G A 1: 110,108,839 C583Y probably damaging Het
Cfap54 A T 10: 92,821,106 L3028Q probably damaging Het
Chd1 A G 17: 15,754,951 S1088G probably benign Het
Chd1 A T 17: 15,770,268 H1694L possibly damaging Het
Cstf3 G T 2: 104,663,390 E580* probably null Het
Dip2a A T 10: 76,294,523 M622K possibly damaging Het
Dlgap1 A T 17: 70,815,207 H877L probably damaging Het
Egfr G T 11: 16,884,260 M122I probably benign Het
Etfbkmt T A 6: 149,147,206 D114E probably damaging Het
Eva1c T C 16: 90,869,663 L158P probably damaging Het
Exo1 G A 1: 175,892,976 V287M probably damaging Het
Fam171a1 T C 2: 3,225,617 Y471H probably damaging Het
Fermt1 T A 2: 132,942,066 T8S probably benign Het
Fgfr2 G T 7: 130,167,774 P630T probably damaging Het
Fmo5 G A 3: 97,651,622 G466E probably damaging Het
Gm5155 A C 7: 17,902,692 E231D probably benign Het
Hcn4 A G 9: 58,843,932 I280M probably benign Het
Ifi208 A C 1: 173,683,608 K443T probably benign Het
Irs3 A G 5: 137,644,741 F145S probably benign Het
Kirrel T A 3: 87,089,595 H300L probably benign Het
Krit1 A G 5: 3,819,326 Q340R probably damaging Het
Lipo5 T C 19: 33,467,749 D140G unknown Het
Lrrtm4 A T 6: 80,022,700 Q365L probably benign Het
Lrwd1 G T 5: 136,131,150 T353K possibly damaging Het
Lsm14a A T 7: 34,353,729 S240R possibly damaging Het
Map3k5 A G 10: 20,108,238 I870V probably benign Het
Mmp17 A T 5: 129,594,614 E76V probably null Het
Mphosph10 A G 7: 64,388,984 F272L probably damaging Het
Myh10 A G 11: 68,764,245 K380R probably damaging Het
Myo3b C T 2: 70,426,888 P1282L probably damaging Het
Nemp2 T C 1: 52,643,079 probably benign Het
Ola1 T C 2: 73,199,434 I114V probably damaging Het
Olfr1066 T A 2: 86,455,435 T279S probably damaging Het
Olfr140 T A 2: 90,051,913 H137L probably benign Het
Pabpc4 T G 4: 123,290,307 D204E probably benign Het
Pigr A T 1: 130,849,493 M679L probably benign Het
Pik3c2b A T 1: 133,070,408 M341L possibly damaging Het
Plin4 T A 17: 56,106,132 T498S probably benign Het
Ppp2r5e A G 12: 75,515,685 S15P possibly damaging Het
Prdm13 T C 4: 21,678,984 Y502C probably damaging Het
Ptprk T C 10: 28,592,054 probably null Het
Rapgef6 T C 11: 54,657,374 S505P probably benign Het
Rgmb G T 17: 15,820,728 S199* probably null Het
Rgsl1 T C 1: 153,827,492 T173A probably damaging Het
Rhobtb1 G T 10: 69,269,912 K102N probably damaging Het
Ripor2 A T 13: 24,674,666 D147V probably damaging Het
Rsad2 A T 12: 26,450,682 V202E probably damaging Het
Slc1a6 A G 10: 78,793,307 N186S probably damaging Het
Soga1 G A 2: 157,023,817 Q1127* probably null Het
Sorbs3 G A 14: 70,184,896 R622* probably null Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Srgap3 T C 6: 112,766,939 Y446C probably damaging Het
Thsd7b C T 1: 129,678,243 R574* probably null Het
Tmem74 A T 15: 43,866,821 Y275* probably null Het
Topors A T 4: 40,262,541 S248T possibly damaging Het
Trpm1 A T 7: 64,208,946 Y239F probably benign Het
Ttn T A 2: 76,718,183 Y30179F possibly damaging Het
Ugt2b34 A T 5: 86,892,865 F399L probably damaging Het
Ush2a A T 1: 188,356,798 I317F probably damaging Het
Usp34 T G 11: 23,343,616 L237V probably damaging Het
Vgf A T 5: 137,032,286 D434V probably damaging Het
Vmn1r179 A G 7: 23,928,675 N97S probably benign Het
Vps13a A G 19: 16,710,387 L899P possibly damaging Het
Vps33b A T 7: 80,274,253 I41F probably damaging Het
Zap70 A T 1: 36,778,218 H210L probably damaging Het
Zc3h8 T C 2: 128,928,915 D300G probably benign Het
Zfp958 C A 8: 4,626,196 H55N possibly damaging Het
Other mutations in Usp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Usp1 APN 4 98934581 splice site probably null
IGL02692:Usp1 APN 4 98928960 missense probably benign 0.00
R1782:Usp1 UTSW 4 98934198 missense probably damaging 1.00
R1991:Usp1 UTSW 4 98934294 missense probably benign 0.00
R1992:Usp1 UTSW 4 98934294 missense probably benign 0.00
R2273:Usp1 UTSW 4 98929842 missense probably damaging 1.00
R2274:Usp1 UTSW 4 98929842 missense probably damaging 1.00
R2275:Usp1 UTSW 4 98929842 missense probably damaging 1.00
R3750:Usp1 UTSW 4 98934120 splice site probably null
R3886:Usp1 UTSW 4 98929736 missense probably damaging 1.00
R4014:Usp1 UTSW 4 98934702 missense probably damaging 1.00
R5141:Usp1 UTSW 4 98934209 missense probably damaging 1.00
R5388:Usp1 UTSW 4 98931057 missense probably benign
R5709:Usp1 UTSW 4 98931123 missense probably damaging 0.99
R6035:Usp1 UTSW 4 98929845 missense probably damaging 1.00
R6035:Usp1 UTSW 4 98929845 missense probably damaging 1.00
R6592:Usp1 UTSW 4 98926519 missense possibly damaging 0.86
R6956:Usp1 UTSW 4 98931006 missense probably damaging 0.96
R7117:Usp1 UTSW 4 98928890 missense possibly damaging 0.59
R7396:Usp1 UTSW 4 98926451 intron probably benign
R7516:Usp1 UTSW 4 98934119 missense probably damaging 1.00
R7590:Usp1 UTSW 4 98934252 missense possibly damaging 0.67
R7828:Usp1 UTSW 4 98932307 missense probably damaging 1.00
R8050:Usp1 UTSW 4 98928913 missense probably benign 0.10
R8085:Usp1 UTSW 4 98928341 missense probably damaging 1.00
R8298:Usp1 UTSW 4 98930899 missense probably damaging 1.00
R8736:Usp1 UTSW 4 98932868 missense probably damaging 1.00
R8801:Usp1 UTSW 4 98934611 missense probably benign
R8844:Usp1 UTSW 4 98934780 missense probably damaging 1.00
R8887:Usp1 UTSW 4 98930948 missense probably benign 0.43
R8899:Usp1 UTSW 4 98931110 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCGGTGGACAAAAGAGC -3'
(R):5'- TACCAACATCTGTCCAGGTCTG -3'

Sequencing Primer
(F):5'- CAAAGCAGATTATGAGCTGTACAAC -3'
(R):5'- CCAGGTCTGTTTAATATTTACAGGG -3'
Posted On2016-07-22