Incidental Mutation 'R5304:Lrwd1'
ID404419
Institutional Source Beutler Lab
Gene Symbol Lrwd1
Ensembl Gene ENSMUSG00000029703
Gene Nameleucine-rich repeats and WD repeat domain containing 1
Synonyms1200011O22Rik, Orca
MMRRC Submission 042887-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.752) question?
Stock #R5304 (G1)
Quality Score94
Status Validated
Chromosome5
Chromosomal Location136122772-136136074 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 136131150 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 353 (T353K)
Ref Sequence ENSEMBL: ENSMUSP00000006301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006301] [ENSMUST00000136634] [ENSMUST00000150406]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006301
AA Change: T353K

PolyPhen 2 Score 0.491 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000006301
Gene: ENSMUSG00000029703
AA Change: T353K

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
LRR_TYP 46 69 3.16e-3 SMART
LRR 90 113 1.58e2 SMART
WD40 271 327 6.36e1 SMART
Blast:WD40 330 380 2e-12 BLAST
WD40 383 423 1.49e-7 SMART
WD40 434 473 2.28e2 SMART
Blast:WD40 484 527 6e-15 BLAST
WD40 542 583 1.42e2 SMART
low complexity region 591 602 N/A INTRINSIC
Blast:WD40 603 646 8e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000128255
SMART Domains Protein: ENSMUSP00000119546
Gene: ENSMUSG00000029703

DomainStartEndE-ValueType
Blast:WD40 13 66 2e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132976
Predicted Effect probably benign
Transcript: ENSMUST00000136634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139908
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148475
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149673
Predicted Effect probably benign
Transcript: ENSMUST00000150406
SMART Domains Protein: ENSMUSP00000121513
Gene: ENSMUSG00000029703

DomainStartEndE-ValueType
LRR_TYP 55 78 3.16e-3 SMART
LRR 99 122 1.58e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199786
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with components of the origin recognition complex (ORC) and regulates the formation of the prereplicative complex. The encoded protein stabilizes the ORC and therefore aids in DNA replication. This protein is required for the G1/S phase transition of the cell cycle. In addition, the encoded protein binds to trimethylated histone H3 in heterochromatin and recruits the ORC and lysine methyltransferases, which help maintain the repressive heterochromatic state. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A T 9: 22,424,232 T49S probably benign Het
Adcy1 C T 11: 7,064,198 A200V probably benign Het
Adgrv1 T C 13: 81,578,253 D551G possibly damaging Het
Aldh3a2 A G 11: 61,253,712 V340A probably damaging Het
Amy1 C A 3: 113,558,364 C393F probably damaging Het
Ankrd16 T C 2: 11,789,734 V310A probably benign Het
Arhgef15 T C 11: 68,947,237 S686G probably null Het
Arid4b T A 13: 14,186,929 N659K probably benign Het
Asz1 C T 6: 18,076,620 R191Q probably benign Het
Atp2a3 A G 11: 72,988,557 I947V probably damaging Het
AW011738 G A 4: 156,203,512 probably benign Het
Bfsp1 G T 2: 143,827,291 T456K probably benign Het
Cdc25c T C 18: 34,750,811 T40A possibly damaging Het
Cdh7 G A 1: 110,108,839 C583Y probably damaging Het
Cfap54 A T 10: 92,821,106 L3028Q probably damaging Het
Chd1 A G 17: 15,754,951 S1088G probably benign Het
Chd1 A T 17: 15,770,268 H1694L possibly damaging Het
Cstf3 G T 2: 104,663,390 E580* probably null Het
Dip2a A T 10: 76,294,523 M622K possibly damaging Het
Dlgap1 A T 17: 70,815,207 H877L probably damaging Het
Egfr G T 11: 16,884,260 M122I probably benign Het
Etfbkmt T A 6: 149,147,206 D114E probably damaging Het
Eva1c T C 16: 90,869,663 L158P probably damaging Het
Exo1 G A 1: 175,892,976 V287M probably damaging Het
Fam171a1 T C 2: 3,225,617 Y471H probably damaging Het
Fermt1 T A 2: 132,942,066 T8S probably benign Het
Fgfr2 G T 7: 130,167,774 P630T probably damaging Het
Fmo5 G A 3: 97,651,622 G466E probably damaging Het
Gm5155 A C 7: 17,902,692 E231D probably benign Het
Hcn4 A G 9: 58,843,932 I280M probably benign Het
Ifi208 A C 1: 173,683,608 K443T probably benign Het
Irs3 A G 5: 137,644,741 F145S probably benign Het
Kirrel T A 3: 87,089,595 H300L probably benign Het
Krit1 A G 5: 3,819,326 Q340R probably damaging Het
Lipo5 T C 19: 33,467,749 D140G unknown Het
Lrrtm4 A T 6: 80,022,700 Q365L probably benign Het
Lsm14a A T 7: 34,353,729 S240R possibly damaging Het
Map3k5 A G 10: 20,108,238 I870V probably benign Het
Mmp17 A T 5: 129,594,614 E76V probably null Het
Mphosph10 A G 7: 64,388,984 F272L probably damaging Het
Myh10 A G 11: 68,764,245 K380R probably damaging Het
Myo3b C T 2: 70,426,888 P1282L probably damaging Het
Nemp2 T C 1: 52,643,079 probably benign Het
Ola1 T C 2: 73,199,434 I114V probably damaging Het
Olfr1066 T A 2: 86,455,435 T279S probably damaging Het
Olfr140 T A 2: 90,051,913 H137L probably benign Het
Pabpc4 T G 4: 123,290,307 D204E probably benign Het
Pigr A T 1: 130,849,493 M679L probably benign Het
Pik3c2b A T 1: 133,070,408 M341L possibly damaging Het
Plin4 T A 17: 56,106,132 T498S probably benign Het
Ppp2r5e A G 12: 75,515,685 S15P possibly damaging Het
Prdm13 T C 4: 21,678,984 Y502C probably damaging Het
Ptprk T C 10: 28,592,054 probably null Het
Rapgef6 T C 11: 54,657,374 S505P probably benign Het
Rgmb G T 17: 15,820,728 S199* probably null Het
Rgsl1 T C 1: 153,827,492 T173A probably damaging Het
Rhobtb1 G T 10: 69,269,912 K102N probably damaging Het
Ripor2 A T 13: 24,674,666 D147V probably damaging Het
Rsad2 A T 12: 26,450,682 V202E probably damaging Het
Slc1a6 A G 10: 78,793,307 N186S probably damaging Het
Soga1 G A 2: 157,023,817 Q1127* probably null Het
Sorbs3 G A 14: 70,184,896 R622* probably null Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Srgap3 T C 6: 112,766,939 Y446C probably damaging Het
Thsd7b C T 1: 129,678,243 R574* probably null Het
Tmem74 A T 15: 43,866,821 Y275* probably null Het
Topors A T 4: 40,262,541 S248T possibly damaging Het
Trpm1 A T 7: 64,208,946 Y239F probably benign Het
Ttn T A 2: 76,718,183 Y30179F possibly damaging Het
Ugt2b34 A T 5: 86,892,865 F399L probably damaging Het
Ush2a A T 1: 188,356,798 I317F probably damaging Het
Usp1 T C 4: 98,934,618 V723A probably benign Het
Usp34 T G 11: 23,343,616 L237V probably damaging Het
Vgf A T 5: 137,032,286 D434V probably damaging Het
Vmn1r179 A G 7: 23,928,675 N97S probably benign Het
Vps13a A G 19: 16,710,387 L899P possibly damaging Het
Vps33b A T 7: 80,274,253 I41F probably damaging Het
Zap70 A T 1: 36,778,218 H210L probably damaging Het
Zc3h8 T C 2: 128,928,915 D300G probably benign Het
Zfp958 C A 8: 4,626,196 H55N possibly damaging Het
Other mutations in Lrwd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01593:Lrwd1 APN 5 136134629 missense probably damaging 1.00
IGL01827:Lrwd1 APN 5 136131518 nonsense probably null
IGL01919:Lrwd1 APN 5 136135875 nonsense probably null
IGL02327:Lrwd1 APN 5 136123464 missense probably damaging 1.00
R0614:Lrwd1 UTSW 5 136123500 missense probably damaging 0.99
R0882:Lrwd1 UTSW 5 136123400 splice site probably null
R1137:Lrwd1 UTSW 5 136133419 missense probably benign 0.01
R1164:Lrwd1 UTSW 5 136130990 missense probably benign 0.00
R1302:Lrwd1 UTSW 5 136132413 missense probably benign 0.05
R1838:Lrwd1 UTSW 5 136132388 missense probably benign 0.00
R2114:Lrwd1 UTSW 5 136130478 missense probably damaging 1.00
R2116:Lrwd1 UTSW 5 136130478 missense probably damaging 1.00
R2117:Lrwd1 UTSW 5 136130478 missense probably damaging 1.00
R4514:Lrwd1 UTSW 5 136131548 missense probably benign 0.00
R4595:Lrwd1 UTSW 5 136123956 missense probably benign
R5384:Lrwd1 UTSW 5 136123874 missense possibly damaging 0.84
R5719:Lrwd1 UTSW 5 136132239 splice site probably null
R5771:Lrwd1 UTSW 5 136123662 missense possibly damaging 0.95
R5791:Lrwd1 UTSW 5 136131033 missense probably benign 0.44
R6431:Lrwd1 UTSW 5 136133034 missense possibly damaging 0.90
R7074:Lrwd1 UTSW 5 136123657 missense probably benign 0.01
R7132:Lrwd1 UTSW 5 136123275 missense possibly damaging 0.71
R7838:Lrwd1 UTSW 5 136132129 missense probably damaging 1.00
R7873:Lrwd1 UTSW 5 136123938 missense probably benign 0.00
R8033:Lrwd1 UTSW 5 136123225 missense probably damaging 1.00
R8738:Lrwd1 UTSW 5 136133403 nonsense probably null
R8828:Lrwd1 UTSW 5 136135933 missense probably benign 0.00
R8841:Lrwd1 UTSW 5 136123183 missense possibly damaging 0.51
Z1176:Lrwd1 UTSW 5 136134008 missense probably damaging 1.00
Z1177:Lrwd1 UTSW 5 136131541 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AAGAGGTGAGTCTCATGGCTG -3'
(R):5'- AACTATTTTGGTGGGGATAGGACC -3'

Sequencing Primer
(F):5'- CTCATGGCTGGGGCTGAAG -3'
(R):5'- GCTTCTCTGTGTTCCAGA -3'
Posted On2016-07-22