Incidental Mutation 'R0417:Sptbn2'
ID 40442
Institutional Source Beutler Lab
Gene Symbol Sptbn2
Ensembl Gene ENSMUSG00000067889
Gene Name spectrin beta, non-erythrocytic 2
Synonyms Spnb3
MMRRC Submission 038619-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0417 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 4711208-4752353 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 4737926 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 978 (T978A)
Ref Sequence ENSEMBL: ENSMUSP00000008991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008991] [ENSMUST00000178353]
AlphaFold Q68FG2
Predicted Effect probably benign
Transcript: ENSMUST00000008991
AA Change: T978A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000008991
Gene: ENSMUSG00000067889
AA Change: T978A

DomainStartEndE-ValueType
CH 59 159 1.86e-28 SMART
CH 178 276 2.86e-20 SMART
SPEC 308 414 4.63e-1 SMART
SPEC 428 528 3.07e-23 SMART
SPEC 534 638 4.47e-25 SMART
SPEC 644 744 1.28e-25 SMART
SPEC 750 849 4.98e-23 SMART
SPEC 855 955 1.63e-18 SMART
SPEC 961 1062 1.45e-24 SMART
SPEC 1068 1169 4.15e-20 SMART
SPEC 1175 1275 5.26e-22 SMART
SPEC 1281 1380 1.17e-19 SMART
SPEC 1386 1485 2.06e-24 SMART
SPEC 1491 1585 1.74e-22 SMART
SPEC 1591 1691 5.42e-24 SMART
SPEC 1697 1798 2.1e-21 SMART
SPEC 1804 1904 5.47e-20 SMART
SPEC 1910 2010 1.99e-22 SMART
SPEC 2016 2256 2.92e-6 SMART
PH 2219 2330 1.65e-14 SMART
low complexity region 2373 2386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178353
SMART Domains Protein: ENSMUSP00000136599
Gene: ENSMUSG00000096370

DomainStartEndE-ValueType
RRM 2 69 1.96e-17 SMART
Pfam:RRM_1 81 118 5.6e-7 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are principle components of a cell's membrane-cytoskeleton and are composed of two alpha and two beta spectrin subunits. The protein encoded by this gene (SPTBN2), is called spectrin beta non-erythrocytic 2 or beta-III spectrin. It is related to, but distinct from, the beta-II spectrin gene which is also known as spectrin beta non-erythrocytic 1 (SPTBN1). SPTBN2 regulates the glutamate signaling pathway by stabilizing the glutamate transporter EAAT4 at the surface of the plasma membrane. Mutations in this gene cause a form of spinocerebellar ataxia, SCA5, that is characterized by neurodegeneration, progressive locomotor incoordination, dysarthria, and uncoordinated eye movements. [provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous hypomorphic mutants exhibit a progressive ataxic phenotype with gait abnormalities, tremor, deteriorating motor coordination, Purkinje cell loss, and cerebellar atrophy (molecular layer thinning) and age-related reduction in simple firing ratein surviving Purkinje cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700027J19Rik A G 7: 4,151,483 L102P probably damaging Het
1700030K09Rik A G 8: 72,445,400 K217R probably damaging Het
1810024B03Rik A G 2: 127,186,944 Y112H probably damaging Het
A430078G23Rik T C 8: 3,388,957 probably benign Het
Acot2 T C 12: 83,990,613 Y234H probably benign Het
Alox12e C T 11: 70,321,865 V53I probably benign Het
Ankrd50 T C 3: 38,456,361 H619R probably damaging Het
Arfgef3 A T 10: 18,603,511 L1452Q probably damaging Het
Arhgap42 T C 9: 9,180,033 S82G possibly damaging Het
Bicra C A 7: 15,972,322 R1398L probably damaging Het
Boc T C 16: 44,520,234 T118A probably benign Het
Btnl9 A G 11: 49,175,595 Y381H probably damaging Het
Cbln3 T G 14: 55,884,129 E20A probably benign Het
Csrnp3 A G 2: 66,019,543 Y171C probably benign Het
Cyp2d9 A T 15: 82,455,951 I181F probably damaging Het
Cyp7b1 T A 3: 18,096,691 T295S probably damaging Het
Dbn1 C T 13: 55,474,916 E585K probably damaging Het
Dok1 A T 6: 83,031,569 D377E probably damaging Het
Eed A T 7: 89,971,552 Y87* probably null Het
Entpd3 T C 9: 120,557,421 V156A probably damaging Het
Exo5 T A 4: 120,922,072 T199S probably damaging Het
Extl2 T C 3: 116,024,357 I106T probably benign Het
Ezh2 A G 6: 47,551,726 C291R probably benign Het
Flvcr1 A T 1: 191,011,219 M466K probably benign Het
Fras1 G T 5: 96,691,372 M1583I probably benign Het
Fzd9 G T 5: 135,249,619 R471S probably damaging Het
Galr1 A T 18: 82,405,540 F204Y probably damaging Het
Gm38394 A T 1: 133,658,538 S354T probably benign Het
Gna11 A T 10: 81,530,904 I324N probably damaging Het
Gucy1a2 A G 9: 3,759,484 E430G possibly damaging Het
Hhatl C T 9: 121,788,762 A254T probably benign Het
Ikzf1 A C 11: 11,769,352 N353T probably benign Het
Il7 T A 3: 7,576,027 T110S probably damaging Het
Keg1 A G 19: 12,711,060 N53D probably damaging Het
Klhl21 T C 4: 152,015,507 I558T probably damaging Het
Lca5l G A 16: 96,162,653 T357M probably damaging Het
Lrba T C 3: 86,715,654 S2448P probably damaging Het
Map3k6 T A 4: 133,248,082 Y709* probably null Het
Megf6 A G 4: 154,267,967 E1261G probably benign Het
Mettl3 C T 14: 52,296,698 G473D probably damaging Het
Mga A G 2: 119,902,790 I40V probably damaging Het
Mmp13 T A 9: 7,276,602 D232E probably benign Het
Nampt T C 12: 32,833,101 V95A probably benign Het
Nbeal1 T C 1: 60,247,734 V905A probably benign Het
Nomo1 A T 7: 46,068,698 E840V possibly damaging Het
Nprl2 A T 9: 107,543,298 I101F probably damaging Het
Nup160 A T 2: 90,735,427 I1378F possibly damaging Het
Ogdhl T C 14: 32,326,979 S69P probably damaging Het
Olfr1105 A T 2: 87,033,445 Y259N probably damaging Het
Olfr1240 C A 2: 89,440,175 V35L possibly damaging Het
Olfr1283 A G 2: 111,369,105 S158G possibly damaging Het
Olfr1390 T A 11: 49,340,673 I47N possibly damaging Het
Olfr143 T C 9: 38,253,864 F149S probably benign Het
Olfr870 G A 9: 20,171,214 A119V probably damaging Het
Olfr894 A G 9: 38,219,455 I211V probably benign Het
Osbpl3 C T 6: 50,348,018 V167I probably benign Het
Pclo T A 5: 14,713,022 H3836Q unknown Het
Prkcg A T 7: 3,304,304 probably null Het
Ror1 A T 4: 100,412,000 H345L possibly damaging Het
Slc36a2 C T 11: 55,181,544 probably null Het
Slc40a1 G A 1: 45,911,374 P306L possibly damaging Het
Slc9a8 C A 2: 167,457,344 T239K probably benign Het
Snapc3 A G 4: 83,450,162 I299V probably benign Het
Sp3 G A 2: 72,971,501 A56V possibly damaging Het
Spag17 T A 3: 100,065,554 S1361T probably benign Het
Stom C A 2: 35,321,632 V126F probably damaging Het
Stpg2 A G 3: 139,218,321 T162A probably damaging Het
Stxbp6 G A 12: 44,902,957 T63M probably damaging Het
Tatdn1 A C 15: 58,921,350 I69S probably benign Het
Tbata A T 10: 61,180,339 D198V probably damaging Het
Tbc1d5 T C 17: 50,756,705 I638V probably benign Het
Tomm70a A G 16: 57,149,903 D548G probably benign Het
Ust A G 10: 8,245,936 F303L probably damaging Het
Vps13d A G 4: 144,976,560 S4306P probably benign Het
Zfp691 A G 4: 119,170,496 S180P possibly damaging Het
Other mutations in Sptbn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Sptbn2 APN 19 4724705 missense possibly damaging 0.94
IGL00688:Sptbn2 APN 19 4725938 missense probably damaging 1.00
IGL01339:Sptbn2 APN 19 4745972 nonsense probably null
IGL01373:Sptbn2 APN 19 4745972 nonsense probably null
IGL01420:Sptbn2 APN 19 4734125 missense probably benign
IGL01456:Sptbn2 APN 19 4746749 missense probably damaging 1.00
IGL01953:Sptbn2 APN 19 4749693 missense probably benign
IGL03026:Sptbn2 APN 19 4724233 critical splice donor site probably null
IGL03275:Sptbn2 APN 19 4732661 missense possibly damaging 0.65
IGL03286:Sptbn2 APN 19 4747832 missense probably damaging 0.97
F5770:Sptbn2 UTSW 19 4750632 missense probably damaging 1.00
PIT4696001:Sptbn2 UTSW 19 4745577 missense probably benign 0.00
R0046:Sptbn2 UTSW 19 4745377 intron probably benign
R0046:Sptbn2 UTSW 19 4745377 intron probably benign
R0121:Sptbn2 UTSW 19 4745293 missense probably damaging 1.00
R0127:Sptbn2 UTSW 19 4724744 missense probably damaging 1.00
R0212:Sptbn2 UTSW 19 4746942 critical splice donor site probably null
R0277:Sptbn2 UTSW 19 4745145 missense probably benign 0.28
R0457:Sptbn2 UTSW 19 4745938 missense possibly damaging 0.89
R0536:Sptbn2 UTSW 19 4726690 missense probably damaging 0.99
R0631:Sptbn2 UTSW 19 4739986 missense probably benign 0.01
R0734:Sptbn2 UTSW 19 4748123 nonsense probably null
R0742:Sptbn2 UTSW 19 4718983 missense possibly damaging 0.46
R1195:Sptbn2 UTSW 19 4745893 missense possibly damaging 0.85
R1195:Sptbn2 UTSW 19 4745893 missense possibly damaging 0.85
R1195:Sptbn2 UTSW 19 4745893 missense possibly damaging 0.85
R1364:Sptbn2 UTSW 19 4732665 missense probably damaging 1.00
R1495:Sptbn2 UTSW 19 4718976 missense possibly damaging 0.92
R1498:Sptbn2 UTSW 19 4744246 missense possibly damaging 0.94
R1606:Sptbn2 UTSW 19 4750242 critical splice donor site probably null
R1678:Sptbn2 UTSW 19 4750497 missense probably damaging 1.00
R1746:Sptbn2 UTSW 19 4745964 nonsense probably null
R1820:Sptbn2 UTSW 19 4726596 missense probably damaging 0.98
R1830:Sptbn2 UTSW 19 4732541 missense probably benign 0.09
R1863:Sptbn2 UTSW 19 4732685 missense possibly damaging 0.54
R1967:Sptbn2 UTSW 19 4745299 missense probably benign 0.00
R2085:Sptbn2 UTSW 19 4738559 missense probably benign 0.09
R2301:Sptbn2 UTSW 19 4734138 missense probably benign 0.00
R2310:Sptbn2 UTSW 19 4718935 missense probably benign 0.19
R2888:Sptbn2 UTSW 19 4748636 missense possibly damaging 0.52
R3788:Sptbn2 UTSW 19 4745922 missense probably damaging 1.00
R4429:Sptbn2 UTSW 19 4738355 missense probably damaging 1.00
R4536:Sptbn2 UTSW 19 4732602 missense probably damaging 1.00
R4662:Sptbn2 UTSW 19 4739239 missense probably damaging 1.00
R4672:Sptbn2 UTSW 19 4732496 missense probably benign 0.25
R4731:Sptbn2 UTSW 19 4742480 missense probably damaging 0.96
R4747:Sptbn2 UTSW 19 4748154 missense probably benign 0.27
R4889:Sptbn2 UTSW 19 4729430 missense possibly damaging 0.69
R4891:Sptbn2 UTSW 19 4738469 missense probably damaging 1.00
R4965:Sptbn2 UTSW 19 4729309 missense probably benign 0.13
R4968:Sptbn2 UTSW 19 4729202 splice site probably null
R4981:Sptbn2 UTSW 19 4751658 missense probably benign 0.22
R5159:Sptbn2 UTSW 19 4737857 missense probably benign 0.12
R5202:Sptbn2 UTSW 19 4724184 missense probably damaging 1.00
R5253:Sptbn2 UTSW 19 4750082 missense probably benign 0.01
R5294:Sptbn2 UTSW 19 4718908 missense possibly damaging 0.67
R5465:Sptbn2 UTSW 19 4750105 missense probably benign 0.00
R5546:Sptbn2 UTSW 19 4725950 missense probably damaging 1.00
R5593:Sptbn2 UTSW 19 4748947 missense probably damaging 1.00
R5780:Sptbn2 UTSW 19 4724667 missense probably damaging 1.00
R5835:Sptbn2 UTSW 19 4738219 missense probably damaging 1.00
R6008:Sptbn2 UTSW 19 4739278 missense possibly damaging 0.89
R6108:Sptbn2 UTSW 19 4731392 critical splice donor site probably null
R6236:Sptbn2 UTSW 19 4748138 missense probably benign 0.01
R6307:Sptbn2 UTSW 19 4724646 missense probably damaging 1.00
R6383:Sptbn2 UTSW 19 4732496 missense possibly damaging 0.89
R6397:Sptbn2 UTSW 19 4742418 missense possibly damaging 0.91
R6453:Sptbn2 UTSW 19 4744180 missense possibly damaging 0.67
R6561:Sptbn2 UTSW 19 4747926 missense probably benign 0.39
R6564:Sptbn2 UTSW 19 4732024 missense probably damaging 1.00
R6644:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R6703:Sptbn2 UTSW 19 4749814 missense probably benign
R6703:Sptbn2 UTSW 19 4749815 missense probably benign
R6753:Sptbn2 UTSW 19 4747785 missense probably benign 0.01
R7007:Sptbn2 UTSW 19 4744145 missense possibly damaging 0.82
R7131:Sptbn2 UTSW 19 4749460 missense probably null
R7219:Sptbn2 UTSW 19 4724173 missense probably damaging 1.00
R7285:Sptbn2 UTSW 19 4737443 missense probably benign 0.00
R7308:Sptbn2 UTSW 19 4751574 missense probably benign
R7469:Sptbn2 UTSW 19 4745118 missense probably benign 0.00
R7502:Sptbn2 UTSW 19 4748082 missense probably benign 0.02
R7623:Sptbn2 UTSW 19 4726168 missense probably damaging 1.00
R7635:Sptbn2 UTSW 19 4744207 missense probably damaging 1.00
R7733:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7738:Sptbn2 UTSW 19 4724125 missense probably damaging 1.00
R7742:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7767:Sptbn2 UTSW 19 4734143 missense possibly damaging 0.62
R7795:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7796:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7871:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7877:Sptbn2 UTSW 19 4744262 missense possibly damaging 0.93
R7920:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7921:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7923:Sptbn2 UTSW 19 4746799 missense probably benign 0.01
R8137:Sptbn2 UTSW 19 4737403 missense possibly damaging 0.81
R8305:Sptbn2 UTSW 19 4729130 missense possibly damaging 0.81
R8695:Sptbn2 UTSW 19 4746696 missense possibly damaging 0.86
R8790:Sptbn2 UTSW 19 4732024 missense probably damaging 1.00
R9125:Sptbn2 UTSW 19 4734213 missense probably benign 0.04
R9483:Sptbn2 UTSW 19 4739946 missense probably damaging 1.00
R9620:Sptbn2 UTSW 19 4750507 missense probably damaging 0.99
R9631:Sptbn2 UTSW 19 4738190 missense probably damaging 1.00
R9646:Sptbn2 UTSW 19 4745313 missense probably damaging 1.00
R9694:Sptbn2 UTSW 19 4750507 missense probably damaging 0.99
V7580:Sptbn2 UTSW 19 4750632 missense probably damaging 1.00
Z1176:Sptbn2 UTSW 19 4738205 missense probably damaging 1.00
Z1176:Sptbn2 UTSW 19 4745191 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAGCCCTTCACATGAGACCTTTTCC -3'
(R):5'- CTCTTACCTGGCTGCTGAGAACAC -3'

Sequencing Primer
(F):5'- TCCCTACTTACAGGTGGCAG -3'
(R):5'- TGGAAGTCATCCAAGCTGC -3'
Posted On 2013-05-23