Incidental Mutation 'R5304:Irs3'
ID404421
Institutional Source Beutler Lab
Gene Symbol Irs3
Ensembl Gene ENSMUSG00000047182
Gene Nameinsulin receptor substrate 3
Synonyms
MMRRC Submission 042887-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5304 (G1)
Quality Score126
Status Validated
Chromosome5
Chromosomal Location137643031-137645714 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 137644741 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 145 (F145S)
Ref Sequence ENSEMBL: ENSMUSP00000142730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031734] [ENSMUST00000057314] [ENSMUST00000166099] [ENSMUST00000175968] [ENSMUST00000176667] [ENSMUST00000177466] [ENSMUST00000196511] [ENSMUST00000177545]
Predicted Effect probably benign
Transcript: ENSMUST00000031734
SMART Domains Protein: ENSMUSP00000031734
Gene: ENSMUSG00000093445

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
LRR 90 112 4.84e1 SMART
LRR_TYP 113 136 4.61e-5 SMART
LRR 158 180 2.63e0 SMART
LRR_TYP 181 204 1.1e-2 SMART
LRR 226 249 3.98e1 SMART
low complexity region 389 405 N/A INTRINSIC
low complexity region 440 453 N/A INTRINSIC
low complexity region 474 479 N/A INTRINSIC
low complexity region 510 530 N/A INTRINSIC
CH 533 642 9.24e-15 SMART
transmembrane domain 656 678 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057314
AA Change: F145S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000060844
Gene: ENSMUSG00000047182
AA Change: F145S

DomainStartEndE-ValueType
PH 33 135 4.46e-11 SMART
IRS 159 272 1.18e-30 SMART
PTBI 159 272 7.23e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166099
SMART Domains Protein: ENSMUSP00000127076
Gene: ENSMUSG00000079165

DomainStartEndE-ValueType
Pfam:SAP25 76 261 1.8e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175968
SMART Domains Protein: ENSMUSP00000134767
Gene: ENSMUSG00000093445

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
LRR 36 58 4.84e1 SMART
LRR_TYP 59 82 4.61e-5 SMART
LRR 104 126 2.63e0 SMART
LRR_TYP 127 150 1.1e-2 SMART
LRR 172 195 3.98e1 SMART
low complexity region 335 351 N/A INTRINSIC
low complexity region 386 399 N/A INTRINSIC
low complexity region 420 425 N/A INTRINSIC
low complexity region 456 476 N/A INTRINSIC
CH 479 588 9.24e-15 SMART
transmembrane domain 602 624 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176075
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176256
Predicted Effect probably benign
Transcript: ENSMUST00000176667
SMART Domains Protein: ENSMUSP00000135832
Gene: ENSMUSG00000093445

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
LRR 90 112 4.84e1 SMART
LRR_TYP 113 136 4.61e-5 SMART
LRR 158 180 2.63e0 SMART
LRR_TYP 181 204 1.1e-2 SMART
LRR 226 249 3.98e1 SMART
low complexity region 389 405 N/A INTRINSIC
low complexity region 440 453 N/A INTRINSIC
low complexity region 474 479 N/A INTRINSIC
low complexity region 510 530 N/A INTRINSIC
CH 533 648 4.73e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177354
Predicted Effect probably benign
Transcript: ENSMUST00000177466
Predicted Effect probably benign
Transcript: ENSMUST00000196511
AA Change: F145S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142730
Gene: ENSMUSG00000047182
AA Change: F145S

DomainStartEndE-ValueType
PH 33 135 4.46e-11 SMART
IRS 159 272 1.18e-30 SMART
PTBI 159 272 7.23e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177545
SMART Domains Protein: ENSMUSP00000135286
Gene: ENSMUSG00000029720

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
LRR 90 112 4.84e1 SMART
LRR_TYP 113 136 4.61e-5 SMART
LRR 158 180 2.63e0 SMART
LRR_TYP 181 204 1.1e-2 SMART
LRR 226 249 3.98e1 SMART
low complexity region 389 405 N/A INTRINSIC
low complexity region 440 453 N/A INTRINSIC
low complexity region 474 479 N/A INTRINSIC
low complexity region 510 530 N/A INTRINSIC
CH 533 642 9.24e-15 SMART
transmembrane domain 656 678 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 99% (87/88)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted mutation are viable, fertile and display no detectable abnormalities in growth or glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A T 9: 22,424,232 T49S probably benign Het
Adcy1 C T 11: 7,064,198 A200V probably benign Het
Adgrv1 T C 13: 81,578,253 D551G possibly damaging Het
Aldh3a2 A G 11: 61,253,712 V340A probably damaging Het
Amy1 C A 3: 113,558,364 C393F probably damaging Het
Ankrd16 T C 2: 11,789,734 V310A probably benign Het
Arhgef15 T C 11: 68,947,237 S686G probably null Het
Arid4b T A 13: 14,186,929 N659K probably benign Het
Asz1 C T 6: 18,076,620 R191Q probably benign Het
Atp2a3 A G 11: 72,988,557 I947V probably damaging Het
AW011738 G A 4: 156,203,512 probably benign Het
Bfsp1 G T 2: 143,827,291 T456K probably benign Het
Cdc25c T C 18: 34,750,811 T40A possibly damaging Het
Cdh7 G A 1: 110,108,839 C583Y probably damaging Het
Cfap54 A T 10: 92,821,106 L3028Q probably damaging Het
Chd1 A G 17: 15,754,951 S1088G probably benign Het
Chd1 A T 17: 15,770,268 H1694L possibly damaging Het
Cstf3 G T 2: 104,663,390 E580* probably null Het
Dip2a A T 10: 76,294,523 M622K possibly damaging Het
Dlgap1 A T 17: 70,815,207 H877L probably damaging Het
Egfr G T 11: 16,884,260 M122I probably benign Het
Etfbkmt T A 6: 149,147,206 D114E probably damaging Het
Eva1c T C 16: 90,869,663 L158P probably damaging Het
Exo1 G A 1: 175,892,976 V287M probably damaging Het
Fam171a1 T C 2: 3,225,617 Y471H probably damaging Het
Fermt1 T A 2: 132,942,066 T8S probably benign Het
Fgfr2 G T 7: 130,167,774 P630T probably damaging Het
Fmo5 G A 3: 97,651,622 G466E probably damaging Het
Gm5155 A C 7: 17,902,692 E231D probably benign Het
Hcn4 A G 9: 58,843,932 I280M probably benign Het
Ifi208 A C 1: 173,683,608 K443T probably benign Het
Kirrel T A 3: 87,089,595 H300L probably benign Het
Krit1 A G 5: 3,819,326 Q340R probably damaging Het
Lipo5 T C 19: 33,467,749 D140G unknown Het
Lrrtm4 A T 6: 80,022,700 Q365L probably benign Het
Lrwd1 G T 5: 136,131,150 T353K possibly damaging Het
Lsm14a A T 7: 34,353,729 S240R possibly damaging Het
Map3k5 A G 10: 20,108,238 I870V probably benign Het
Mmp17 A T 5: 129,594,614 E76V probably null Het
Mphosph10 A G 7: 64,388,984 F272L probably damaging Het
Myh10 A G 11: 68,764,245 K380R probably damaging Het
Myo3b C T 2: 70,426,888 P1282L probably damaging Het
Nemp2 T C 1: 52,643,079 probably benign Het
Ola1 T C 2: 73,199,434 I114V probably damaging Het
Olfr1066 T A 2: 86,455,435 T279S probably damaging Het
Olfr140 T A 2: 90,051,913 H137L probably benign Het
Pabpc4 T G 4: 123,290,307 D204E probably benign Het
Pigr A T 1: 130,849,493 M679L probably benign Het
Pik3c2b A T 1: 133,070,408 M341L possibly damaging Het
Plin4 T A 17: 56,106,132 T498S probably benign Het
Ppp2r5e A G 12: 75,515,685 S15P possibly damaging Het
Prdm13 T C 4: 21,678,984 Y502C probably damaging Het
Ptprk T C 10: 28,592,054 probably null Het
Rapgef6 T C 11: 54,657,374 S505P probably benign Het
Rgmb G T 17: 15,820,728 S199* probably null Het
Rgsl1 T C 1: 153,827,492 T173A probably damaging Het
Rhobtb1 G T 10: 69,269,912 K102N probably damaging Het
Ripor2 A T 13: 24,674,666 D147V probably damaging Het
Rsad2 A T 12: 26,450,682 V202E probably damaging Het
Slc1a6 A G 10: 78,793,307 N186S probably damaging Het
Soga1 G A 2: 157,023,817 Q1127* probably null Het
Sorbs3 G A 14: 70,184,896 R622* probably null Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Srgap3 T C 6: 112,766,939 Y446C probably damaging Het
Thsd7b C T 1: 129,678,243 R574* probably null Het
Tmem74 A T 15: 43,866,821 Y275* probably null Het
Topors A T 4: 40,262,541 S248T possibly damaging Het
Trpm1 A T 7: 64,208,946 Y239F probably benign Het
Ttn T A 2: 76,718,183 Y30179F possibly damaging Het
Ugt2b34 A T 5: 86,892,865 F399L probably damaging Het
Ush2a A T 1: 188,356,798 I317F probably damaging Het
Usp1 T C 4: 98,934,618 V723A probably benign Het
Usp34 T G 11: 23,343,616 L237V probably damaging Het
Vgf A T 5: 137,032,286 D434V probably damaging Het
Vmn1r179 A G 7: 23,928,675 N97S probably benign Het
Vps13a A G 19: 16,710,387 L899P possibly damaging Het
Vps33b A T 7: 80,274,253 I41F probably damaging Het
Zap70 A T 1: 36,778,218 H210L probably damaging Het
Zc3h8 T C 2: 128,928,915 D300G probably benign Het
Zfp958 C A 8: 4,626,196 H55N possibly damaging Het
Other mutations in Irs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01403:Irs3 APN 5 137645319 missense probably damaging 1.00
R0412:Irs3 UTSW 5 137643877 missense probably benign 0.04
R0544:Irs3 UTSW 5 137643839 missense probably benign 0.00
R1316:Irs3 UTSW 5 137644441 missense probably damaging 1.00
R1653:Irs3 UTSW 5 137644521 missense probably damaging 1.00
R2158:Irs3 UTSW 5 137644699 missense probably damaging 1.00
R3115:Irs3 UTSW 5 137643856 missense probably benign 0.01
R4746:Irs3 UTSW 5 137643947 missense probably benign
R4971:Irs3 UTSW 5 137644492 missense probably damaging 1.00
R5834:Irs3 UTSW 5 137644559 missense probably damaging 1.00
R5844:Irs3 UTSW 5 137644286 missense probably benign
R6770:Irs3 UTSW 5 137645213 missense possibly damaging 0.86
R7003:Irs3 UTSW 5 137645277 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TGGAACCTTTGCTTCCAGGC -3'
(R):5'- GCCGACTTAGTTTATCTTGAACCC -3'

Sequencing Primer
(F):5'- TTCCAGGCTTTCGCAGGAG -3'
(R):5'- TGGAACTCACTCTGTAGACCAGG -3'
Posted On2016-07-22