Incidental Mutation 'R5304:Trpm1'
ID 404431
Institutional Source Beutler Lab
Gene Symbol Trpm1
Ensembl Gene ENSMUSG00000030523
Gene Name transient receptor potential cation channel, subfamily M, member 1
Synonyms Mlsn1, melastatin, 4732499L03Rik, LTRPC1
MMRRC Submission 042887-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5304 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 63803583-63919523 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 63858694 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 239 (Y239F)
Ref Sequence ENSEMBL: ENSMUSP00000146265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000177102] [ENSMUST00000205348] [ENSMUST00000206277] [ENSMUST00000206263] [ENSMUST00000206706] [ENSMUST00000205731] [ENSMUST00000206314] [ENSMUST00000205994]
AlphaFold Q2TV84
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083651
Predicted Effect probably benign
Transcript: ENSMUST00000085222
AA Change: Y372F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: Y372F

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 456 491 N/A INTRINSIC
Blast:ANK 505 533 1e-5 BLAST
low complexity region 621 650 N/A INTRINSIC
low complexity region 823 835 N/A INTRINSIC
transmembrane domain 876 895 N/A INTRINSIC
Pfam:Ion_trans 907 1120 6e-16 PFAM
transmembrane domain 1150 1167 N/A INTRINSIC
low complexity region 1216 1225 N/A INTRINSIC
PDB:3E7K|H 1228 1279 1e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000107515
AA Change: Y239F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000103139
Gene: ENSMUSG00000030523
AA Change: Y239F

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
low complexity region 323 358 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107516
AA Change: I372F
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141574
AA Change: Y428F
Predicted Effect probably benign
Transcript: ENSMUST00000177102
AA Change: Y256F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134947
Gene: ENSMUSG00000030523
AA Change: Y256F

DomainStartEndE-ValueType
low complexity region 67 79 N/A INTRINSIC
low complexity region 173 191 N/A INTRINSIC
low complexity region 340 375 N/A INTRINSIC
Blast:ANK 389 417 1e-5 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000205348
AA Change: Y372F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205610
Predicted Effect probably benign
Transcript: ENSMUST00000206277
AA Change: Y372F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000206263
AA Change: Y256F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000206706
AA Change: Y239F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000205731
AA Change: Y256F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000206314
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206453
Predicted Effect probably benign
Transcript: ENSMUST00000205994
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206404
Predicted Effect probably benign
Transcript: ENSMUST00000205684
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 C T 11: 7,014,198 (GRCm39) A200V probably benign Het
Adgrv1 T C 13: 81,726,372 (GRCm39) D551G possibly damaging Het
Aldh3a2 A G 11: 61,144,538 (GRCm39) V340A probably damaging Het
Amy1 C A 3: 113,352,013 (GRCm39) C393F probably damaging Het
Ankrd16 T C 2: 11,794,545 (GRCm39) V310A probably benign Het
Arhgef15 T C 11: 68,838,063 (GRCm39) S686G probably null Het
Arid4b T A 13: 14,361,514 (GRCm39) N659K probably benign Het
Asz1 C T 6: 18,076,619 (GRCm39) R191Q probably benign Het
Atp2a3 A G 11: 72,879,383 (GRCm39) I947V probably damaging Het
AW011738 G A 4: 156,287,969 (GRCm39) probably benign Het
Bfsp1 G T 2: 143,669,211 (GRCm39) T456K probably benign Het
Cdc25c T C 18: 34,883,864 (GRCm39) T40A possibly damaging Het
Cdh20 G A 1: 110,036,569 (GRCm39) C583Y probably damaging Het
Ceacam23 A C 7: 17,636,617 (GRCm39) E231D probably benign Het
Cfap54 A T 10: 92,656,968 (GRCm39) L3028Q probably damaging Het
Chd1 A G 17: 15,975,213 (GRCm39) S1088G probably benign Het
Chd1 A T 17: 15,990,530 (GRCm39) H1694L possibly damaging Het
Cstf3 G T 2: 104,493,735 (GRCm39) E580* probably null Het
Dip2a A T 10: 76,130,357 (GRCm39) M622K possibly damaging Het
Dlgap1 A T 17: 71,122,202 (GRCm39) H877L probably damaging Het
Egfr G T 11: 16,834,260 (GRCm39) M122I probably benign Het
Etfbkmt T A 6: 149,048,704 (GRCm39) D114E probably damaging Het
Eva1c T C 16: 90,666,551 (GRCm39) L158P probably damaging Het
Exo1 G A 1: 175,720,542 (GRCm39) V287M probably damaging Het
Fam171a1 T C 2: 3,226,654 (GRCm39) Y471H probably damaging Het
Fermt1 T A 2: 132,783,986 (GRCm39) T8S probably benign Het
Fgfr2 G T 7: 129,769,504 (GRCm39) P630T probably damaging Het
Fmo5 G A 3: 97,558,938 (GRCm39) G466E probably damaging Het
Hcn4 A G 9: 58,751,215 (GRCm39) I280M probably benign Het
Ifi208 A C 1: 173,511,174 (GRCm39) K443T probably benign Het
Irs3 A G 5: 137,643,003 (GRCm39) F145S probably benign Het
Kirrel1 T A 3: 86,996,902 (GRCm39) H300L probably benign Het
Krit1 A G 5: 3,869,326 (GRCm39) Q340R probably damaging Het
Lipo5 T C 19: 33,445,149 (GRCm39) D140G unknown Het
Lrrtm4 A T 6: 79,999,683 (GRCm39) Q365L probably benign Het
Lrwd1 G T 5: 136,160,004 (GRCm39) T353K possibly damaging Het
Lsm14a A T 7: 34,053,154 (GRCm39) S240R possibly damaging Het
Map3k5 A G 10: 19,983,984 (GRCm39) I870V probably benign Het
Matcap2 A T 9: 22,335,528 (GRCm39) T49S probably benign Het
Mmp17 A T 5: 129,671,678 (GRCm39) E76V probably null Het
Mphosph10 A G 7: 64,038,732 (GRCm39) F272L probably damaging Het
Mtcl2 G A 2: 156,865,737 (GRCm39) Q1127* probably null Het
Myh10 A G 11: 68,655,071 (GRCm39) K380R probably damaging Het
Myo3b C T 2: 70,257,232 (GRCm39) P1282L probably damaging Het
Nemp2 T C 1: 52,682,238 (GRCm39) probably benign Het
Ola1 T C 2: 73,029,778 (GRCm39) I114V probably damaging Het
Or4c3d T A 2: 89,882,257 (GRCm39) H137L probably benign Het
Or8k28 T A 2: 86,285,779 (GRCm39) T279S probably damaging Het
Pabpc4 T G 4: 123,184,100 (GRCm39) D204E probably benign Het
Pigr A T 1: 130,777,230 (GRCm39) M679L probably benign Het
Pik3c2b A T 1: 132,998,146 (GRCm39) M341L possibly damaging Het
Plin4 T A 17: 56,413,132 (GRCm39) T498S probably benign Het
Ppp2r5e A G 12: 75,562,459 (GRCm39) S15P possibly damaging Het
Prdm13 T C 4: 21,678,984 (GRCm39) Y502C probably damaging Het
Ptprk T C 10: 28,468,050 (GRCm39) probably null Het
Rapgef6 T C 11: 54,548,200 (GRCm39) S505P probably benign Het
Rgmb G T 17: 16,040,990 (GRCm39) S199* probably null Het
Rgsl1 T C 1: 153,703,238 (GRCm39) T173A probably damaging Het
Rhobtb1 G T 10: 69,105,742 (GRCm39) K102N probably damaging Het
Ripor2 A T 13: 24,858,649 (GRCm39) D147V probably damaging Het
Rsad2 A T 12: 26,500,681 (GRCm39) V202E probably damaging Het
Slc1a6 A G 10: 78,629,141 (GRCm39) N186S probably damaging Het
Sorbs3 G A 14: 70,422,345 (GRCm39) R622* probably null Het
Spag9 C A 11: 93,959,838 (GRCm39) D342E probably damaging Het
Srgap3 T C 6: 112,743,900 (GRCm39) Y446C probably damaging Het
Thsd7b C T 1: 129,605,980 (GRCm39) R574* probably null Het
Tmem74 A T 15: 43,730,217 (GRCm39) Y275* probably null Het
Topors A T 4: 40,262,541 (GRCm39) S248T possibly damaging Het
Ttn T A 2: 76,548,527 (GRCm39) Y30179F possibly damaging Het
Ugt2b34 A T 5: 87,040,724 (GRCm39) F399L probably damaging Het
Ush2a A T 1: 188,088,995 (GRCm39) I317F probably damaging Het
Usp1 T C 4: 98,822,855 (GRCm39) V723A probably benign Het
Usp34 T G 11: 23,293,616 (GRCm39) L237V probably damaging Het
Vgf A T 5: 137,061,140 (GRCm39) D434V probably damaging Het
Vmn1r179 A G 7: 23,628,100 (GRCm39) N97S probably benign Het
Vps13a A G 19: 16,687,751 (GRCm39) L899P possibly damaging Het
Vps33b A T 7: 79,924,001 (GRCm39) I41F probably damaging Het
Zap70 A T 1: 36,817,299 (GRCm39) H210L probably damaging Het
Zc3h8 T C 2: 128,770,835 (GRCm39) D300G probably benign Het
Zfp958 C A 8: 4,676,196 (GRCm39) H55N possibly damaging Het
Other mutations in Trpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Trpm1 APN 7 63,893,198 (GRCm39) missense probably damaging 1.00
IGL00465:Trpm1 APN 7 63,897,215 (GRCm39) missense possibly damaging 0.94
IGL01118:Trpm1 APN 7 63,885,572 (GRCm39) missense probably benign 0.24
IGL01148:Trpm1 APN 7 63,893,312 (GRCm39) missense probably damaging 1.00
IGL01303:Trpm1 APN 7 63,860,578 (GRCm39) critical splice acceptor site probably benign 0.00
IGL01432:Trpm1 APN 7 63,884,767 (GRCm39) missense probably benign 0.18
IGL01433:Trpm1 APN 7 63,854,276 (GRCm39) missense probably damaging 1.00
IGL01506:Trpm1 APN 7 63,893,329 (GRCm39) missense probably damaging 1.00
IGL01626:Trpm1 APN 7 63,918,637 (GRCm39) missense probably damaging 1.00
IGL01640:Trpm1 APN 7 63,876,645 (GRCm39) missense probably damaging 1.00
IGL01899:Trpm1 APN 7 63,884,742 (GRCm39) missense probably benign 0.24
IGL01959:Trpm1 APN 7 63,858,723 (GRCm39) missense possibly damaging 0.81
IGL02210:Trpm1 APN 7 63,860,613 (GRCm39) missense probably damaging 1.00
IGL02268:Trpm1 APN 7 63,867,362 (GRCm39) missense probably damaging 0.96
IGL02331:Trpm1 APN 7 63,884,800 (GRCm39) missense probably benign 0.30
IGL02334:Trpm1 APN 7 63,895,690 (GRCm39) critical splice acceptor site probably null
IGL02407:Trpm1 APN 7 63,868,869 (GRCm39) missense probably damaging 1.00
IGL02425:Trpm1 APN 7 63,890,175 (GRCm39) missense probably damaging 0.96
IGL02485:Trpm1 APN 7 63,918,862 (GRCm39) missense possibly damaging 0.52
IGL02635:Trpm1 APN 7 63,848,972 (GRCm39) missense probably benign 0.00
IGL02640:Trpm1 APN 7 63,868,881 (GRCm39) missense probably damaging 0.97
IGL02827:Trpm1 APN 7 63,868,908 (GRCm39) missense probably null 1.00
PIT4458001:Trpm1 UTSW 7 63,918,309 (GRCm39) missense possibly damaging 0.94
PIT4544001:Trpm1 UTSW 7 63,848,998 (GRCm39) intron probably benign
R0012:Trpm1 UTSW 7 63,918,339 (GRCm39) missense possibly damaging 0.88
R0014:Trpm1 UTSW 7 63,897,970 (GRCm39) missense probably damaging 1.00
R0056:Trpm1 UTSW 7 63,893,334 (GRCm39) missense probably damaging 1.00
R0445:Trpm1 UTSW 7 63,894,590 (GRCm39) unclassified probably benign
R0463:Trpm1 UTSW 7 63,870,002 (GRCm39) missense probably benign 0.05
R0469:Trpm1 UTSW 7 63,873,506 (GRCm39) missense probably damaging 1.00
R0510:Trpm1 UTSW 7 63,873,506 (GRCm39) missense probably damaging 1.00
R1301:Trpm1 UTSW 7 63,852,801 (GRCm39) splice site probably null
R1397:Trpm1 UTSW 7 63,867,406 (GRCm39) missense probably damaging 1.00
R1588:Trpm1 UTSW 7 63,873,565 (GRCm39) missense possibly damaging 0.93
R1618:Trpm1 UTSW 7 63,890,283 (GRCm39) missense probably damaging 1.00
R1724:Trpm1 UTSW 7 63,885,569 (GRCm39) nonsense probably null
R1827:Trpm1 UTSW 7 63,884,755 (GRCm39) missense probably damaging 1.00
R1829:Trpm1 UTSW 7 63,876,530 (GRCm39) missense probably damaging 1.00
R1835:Trpm1 UTSW 7 63,880,016 (GRCm39) missense probably damaging 1.00
R1864:Trpm1 UTSW 7 63,917,764 (GRCm39) missense probably damaging 1.00
R1895:Trpm1 UTSW 7 63,873,556 (GRCm39) missense probably damaging 1.00
R1946:Trpm1 UTSW 7 63,873,556 (GRCm39) missense probably damaging 1.00
R1959:Trpm1 UTSW 7 63,879,978 (GRCm39) missense probably damaging 1.00
R1960:Trpm1 UTSW 7 63,879,978 (GRCm39) missense probably damaging 1.00
R1980:Trpm1 UTSW 7 63,858,182 (GRCm39) missense possibly damaging 0.83
R1989:Trpm1 UTSW 7 63,858,780 (GRCm39) intron probably null
R2054:Trpm1 UTSW 7 63,890,303 (GRCm39) missense possibly damaging 0.69
R2156:Trpm1 UTSW 7 63,884,736 (GRCm39) missense probably damaging 1.00
R2251:Trpm1 UTSW 7 63,859,724 (GRCm39) missense probably damaging 1.00
R3051:Trpm1 UTSW 7 63,918,849 (GRCm39) missense probably damaging 1.00
R3148:Trpm1 UTSW 7 63,884,760 (GRCm39) missense probably benign 0.00
R3195:Trpm1 UTSW 7 63,849,061 (GRCm39) nonsense probably null
R3615:Trpm1 UTSW 7 63,893,318 (GRCm39) missense probably damaging 1.00
R3616:Trpm1 UTSW 7 63,893,318 (GRCm39) missense probably damaging 1.00
R3623:Trpm1 UTSW 7 63,894,601 (GRCm39) missense probably damaging 1.00
R3624:Trpm1 UTSW 7 63,894,601 (GRCm39) missense probably damaging 1.00
R3721:Trpm1 UTSW 7 63,867,475 (GRCm39) intron probably benign
R3822:Trpm1 UTSW 7 63,867,451 (GRCm39) intron probably benign
R4441:Trpm1 UTSW 7 63,851,666 (GRCm39) missense probably damaging 1.00
R4490:Trpm1 UTSW 7 63,858,660 (GRCm39) nonsense probably null
R4666:Trpm1 UTSW 7 63,852,782 (GRCm39) missense probably damaging 1.00
R4701:Trpm1 UTSW 7 63,893,248 (GRCm39) missense probably damaging 1.00
R4781:Trpm1 UTSW 7 63,884,800 (GRCm39) missense probably benign 0.30
R4811:Trpm1 UTSW 7 63,858,054 (GRCm39) missense probably damaging 1.00
R5017:Trpm1 UTSW 7 63,894,580 (GRCm39) unclassified probably benign
R5030:Trpm1 UTSW 7 63,885,579 (GRCm39) missense probably damaging 1.00
R5195:Trpm1 UTSW 7 63,887,441 (GRCm39) missense possibly damaging 0.84
R5238:Trpm1 UTSW 7 63,918,702 (GRCm39) missense probably damaging 1.00
R5575:Trpm1 UTSW 7 63,870,018 (GRCm39) missense possibly damaging 0.95
R5613:Trpm1 UTSW 7 63,858,159 (GRCm39) missense probably damaging 1.00
R5855:Trpm1 UTSW 7 63,918,710 (GRCm39) nonsense probably null
R5947:Trpm1 UTSW 7 63,873,547 (GRCm39) missense probably benign 0.07
R5988:Trpm1 UTSW 7 63,876,553 (GRCm39) missense probably benign 0.16
R6054:Trpm1 UTSW 7 63,918,450 (GRCm39) missense probably benign 0.00
R6088:Trpm1 UTSW 7 63,917,724 (GRCm39) missense probably damaging 0.98
R6259:Trpm1 UTSW 7 63,918,226 (GRCm39) missense possibly damaging 0.47
R6379:Trpm1 UTSW 7 63,848,942 (GRCm39) missense probably benign 0.00
R6380:Trpm1 UTSW 7 63,918,045 (GRCm39) missense probably benign 0.24
R6429:Trpm1 UTSW 7 63,918,252 (GRCm39) missense probably benign 0.00
R6600:Trpm1 UTSW 7 63,803,781 (GRCm39) start codon destroyed probably null 0.56
R6622:Trpm1 UTSW 7 63,890,343 (GRCm39) missense probably damaging 0.96
R6939:Trpm1 UTSW 7 63,918,045 (GRCm39) missense probably benign 0.03
R6944:Trpm1 UTSW 7 63,893,181 (GRCm39) missense probably damaging 1.00
R7025:Trpm1 UTSW 7 63,876,462 (GRCm39) critical splice acceptor site probably null
R7112:Trpm1 UTSW 7 63,885,593 (GRCm39) missense probably damaging 0.97
R7168:Trpm1 UTSW 7 63,918,445 (GRCm39) missense probably benign 0.01
R7219:Trpm1 UTSW 7 63,854,333 (GRCm39) missense possibly damaging 0.68
R7224:Trpm1 UTSW 7 63,868,854 (GRCm39) critical splice acceptor site probably null
R7285:Trpm1 UTSW 7 63,859,729 (GRCm39) nonsense probably null
R7367:Trpm1 UTSW 7 63,918,549 (GRCm39) missense probably benign 0.06
R7449:Trpm1 UTSW 7 63,858,723 (GRCm39) missense probably benign 0.14
R7466:Trpm1 UTSW 7 63,890,330 (GRCm39) missense probably damaging 0.99
R7498:Trpm1 UTSW 7 63,858,657 (GRCm39) missense possibly damaging 0.93
R7581:Trpm1 UTSW 7 63,854,303 (GRCm39) missense probably benign 0.00
R7776:Trpm1 UTSW 7 63,897,939 (GRCm39) missense probably benign 0.04
R8062:Trpm1 UTSW 7 63,851,689 (GRCm39) missense probably benign 0.18
R8069:Trpm1 UTSW 7 63,858,718 (GRCm39) missense possibly damaging 0.55
R8157:Trpm1 UTSW 7 63,849,017 (GRCm39) missense probably damaging 1.00
R8219:Trpm1 UTSW 7 63,851,699 (GRCm39) missense probably benign 0.35
R8258:Trpm1 UTSW 7 63,918,777 (GRCm39) missense probably benign 0.10
R8259:Trpm1 UTSW 7 63,918,777 (GRCm39) missense probably benign 0.10
R8320:Trpm1 UTSW 7 63,918,541 (GRCm39) missense possibly damaging 0.56
R8536:Trpm1 UTSW 7 63,897,155 (GRCm39) missense probably damaging 1.00
R8544:Trpm1 UTSW 7 63,874,356 (GRCm39) splice site probably null
R8813:Trpm1 UTSW 7 63,851,756 (GRCm39) missense possibly damaging 0.68
R8912:Trpm1 UTSW 7 63,918,628 (GRCm39) missense probably benign 0.06
R8954:Trpm1 UTSW 7 63,858,089 (GRCm39) missense probably damaging 0.98
R9139:Trpm1 UTSW 7 63,848,943 (GRCm39) missense probably benign 0.00
R9205:Trpm1 UTSW 7 63,890,319 (GRCm39) missense possibly damaging 0.66
R9258:Trpm1 UTSW 7 63,884,713 (GRCm39) missense probably benign 0.01
R9283:Trpm1 UTSW 7 63,873,623 (GRCm39) missense probably benign 0.18
R9394:Trpm1 UTSW 7 63,918,480 (GRCm39) missense probably benign 0.00
R9430:Trpm1 UTSW 7 63,873,446 (GRCm39) missense probably benign 0.38
R9537:Trpm1 UTSW 7 63,803,616 (GRCm39) unclassified probably benign
R9616:Trpm1 UTSW 7 63,858,132 (GRCm39) missense probably damaging 0.99
R9774:Trpm1 UTSW 7 63,898,041 (GRCm39) missense possibly damaging 0.90
X0026:Trpm1 UTSW 7 63,918,658 (GRCm39) missense probably benign 0.05
Z1176:Trpm1 UTSW 7 63,854,342 (GRCm39) critical splice donor site probably null
Z1176:Trpm1 UTSW 7 63,852,879 (GRCm39) critical splice donor site probably null
Z1177:Trpm1 UTSW 7 63,867,439 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TCTCATCCATTAGCAGTCCAAAATC -3'
(R):5'- TTCCTTCAGGGTTGCACTGG -3'

Sequencing Primer
(F):5'- TCCAAAATCAAAAGTACTGGGTG -3'
(R):5'- GGGATGAGTTCATAAGCTGCC -3'
Posted On 2016-07-22