Mutagenetix > Incidental Mutation

Incidental Mutation 'R5304:Trpm1'

404431

Institutional Source

Beutler Lab

Gene Symbol

Trpm1

Ensembl Gene

ENSMUSG00000030523

Gene Name

transient receptor potential cation channel, subfamily M, member 1

Synonyms

Mlsn1, 4732499L03Rik, LTRPC1, melastatin

MMRRC Submission

042887-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5304 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

64153835-64269775 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 64208946 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 239 (Y239F)

Ref Sequence

ENSEMBL: ENSMUSP00000146265 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000177102] [ENSMUST00000205348] [ENSMUST00000205731] [ENSMUST00000206277] [ENSMUST00000206263] [ENSMUST00000206706] [ENSMUST00000206314] [ENSMUST00000205994]

AlphaFold

Q2TV84

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083651

Predicted Effect

probably benign
Transcript: ENSMUST00000085222
AA Change: Y372F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: Y372F

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
transmembrane domain	876	895	N/A	INTRINSIC
Pfam:Ion_trans	907	1120	6e-16	PFAM
transmembrane domain	1150	1167	N/A	INTRINSIC
low complexity region	1216	1225	N/A	INTRINSIC
PDB:3E7K\|H	1228	1279	1e-7	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000107515
AA Change: Y239F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000103139
Gene: ENSMUSG00000030523
AA Change: Y239F

Domain	Start	End	E-Value	Type
low complexity region	50	62	N/A	INTRINSIC
low complexity region	156	174	N/A	INTRINSIC
low complexity region	323	358	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000107516
AA Change: I372F

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141574
AA Change: Y428F

Predicted Effect

probably benign
Transcript: ENSMUST00000177102
AA Change: Y256F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000134947
Gene: ENSMUSG00000030523
AA Change: Y256F

Domain	Start	End	E-Value	Type
low complexity region	67	79	N/A	INTRINSIC
low complexity region	173	191	N/A	INTRINSIC
low complexity region	340	375	N/A	INTRINSIC
Blast:ANK	389	417	1e-5	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000205348
AA Change: Y372F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205434

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205610

Predicted Effect

probably benign
Transcript: ENSMUST00000205684

Predicted Effect

probably benign
Transcript: ENSMUST00000205731
AA Change: Y256F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205960

Predicted Effect

probably benign
Transcript: ENSMUST00000206277
AA Change: Y372F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000206263
AA Change: Y256F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000206706
AA Change: Y239F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

Predicted Effect

probably benign
Transcript: ENSMUST00000206314

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206453

Predicted Effect

probably benign
Transcript: ENSMUST00000205994

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206404

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 95.9%

Validation Efficiency

99% (87/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530077C05Rik	A	T	9: 22,424,232	T49S	probably benign	Het
Adcy1	C	T	11: 7,064,198	A200V	probably benign	Het
Adgrv1	T	C	13: 81,578,253	D551G	possibly damaging	Het
Aldh3a2	A	G	11: 61,253,712	V340A	probably damaging	Het
Amy1	C	A	3: 113,558,364	C393F	probably damaging	Het
Ankrd16	T	C	2: 11,789,734	V310A	probably benign	Het
Arhgef15	T	C	11: 68,947,237	S686G	probably null	Het
Arid4b	T	A	13: 14,186,929	N659K	probably benign	Het
Asz1	C	T	6: 18,076,620	R191Q	probably benign	Het
Atp2a3	A	G	11: 72,988,557	I947V	probably damaging	Het
AW011738	G	A	4: 156,203,512		probably benign	Het
Bfsp1	G	T	2: 143,827,291	T456K	probably benign	Het
Cdc25c	T	C	18: 34,750,811	T40A	possibly damaging	Het
Cdh7	G	A	1: 110,108,839	C583Y	probably damaging	Het
Cfap54	A	T	10: 92,821,106	L3028Q	probably damaging	Het
Chd1	A	G	17: 15,754,951	S1088G	probably benign	Het
Chd1	A	T	17: 15,770,268	H1694L	possibly damaging	Het
Cstf3	G	T	2: 104,663,390	E580*	probably null	Het
Dip2a	A	T	10: 76,294,523	M622K	possibly damaging	Het
Dlgap1	A	T	17: 70,815,207	H877L	probably damaging	Het
Egfr	G	T	11: 16,884,260	M122I	probably benign	Het
Etfbkmt	T	A	6: 149,147,206	D114E	probably damaging	Het
Eva1c	T	C	16: 90,869,663	L158P	probably damaging	Het
Exo1	G	A	1: 175,892,976	V287M	probably damaging	Het
Fam171a1	T	C	2: 3,225,617	Y471H	probably damaging	Het
Fermt1	T	A	2: 132,942,066	T8S	probably benign	Het
Fgfr2	G	T	7: 130,167,774	P630T	probably damaging	Het
Fmo5	G	A	3: 97,651,622	G466E	probably damaging	Het
Gm5155	A	C	7: 17,902,692	E231D	probably benign	Het
Hcn4	A	G	9: 58,843,932	I280M	probably benign	Het
Ifi208	A	C	1: 173,683,608	K443T	probably benign	Het
Irs3	A	G	5: 137,644,741	F145S	probably benign	Het
Kirrel	T	A	3: 87,089,595	H300L	probably benign	Het
Krit1	A	G	5: 3,819,326	Q340R	probably damaging	Het
Lipo5	T	C	19: 33,467,749	D140G	unknown	Het
Lrrtm4	A	T	6: 80,022,700	Q365L	probably benign	Het
Lrwd1	G	T	5: 136,131,150	T353K	possibly damaging	Het
Lsm14a	A	T	7: 34,353,729	S240R	possibly damaging	Het
Map3k5	A	G	10: 20,108,238	I870V	probably benign	Het
Mmp17	A	T	5: 129,594,614	E76V	probably null	Het
Mphosph10	A	G	7: 64,388,984	F272L	probably damaging	Het
Myh10	A	G	11: 68,764,245	K380R	probably damaging	Het
Myo3b	C	T	2: 70,426,888	P1282L	probably damaging	Het
Nemp2	T	C	1: 52,643,079		probably benign	Het
Ola1	T	C	2: 73,199,434	I114V	probably damaging	Het
Olfr1066	T	A	2: 86,455,435	T279S	probably damaging	Het
Olfr140	T	A	2: 90,051,913	H137L	probably benign	Het
Pabpc4	T	G	4: 123,290,307	D204E	probably benign	Het
Pigr	A	T	1: 130,849,493	M679L	probably benign	Het
Pik3c2b	A	T	1: 133,070,408	M341L	possibly damaging	Het
Plin4	T	A	17: 56,106,132	T498S	probably benign	Het
Ppp2r5e	A	G	12: 75,515,685	S15P	possibly damaging	Het
Prdm13	T	C	4: 21,678,984	Y502C	probably damaging	Het
Ptprk	T	C	10: 28,592,054		probably null	Het
Rapgef6	T	C	11: 54,657,374	S505P	probably benign	Het
Rgmb	G	T	17: 15,820,728	S199*	probably null	Het
Rgsl1	T	C	1: 153,827,492	T173A	probably damaging	Het
Rhobtb1	G	T	10: 69,269,912	K102N	probably damaging	Het
Ripor2	A	T	13: 24,674,666	D147V	probably damaging	Het
Rsad2	A	T	12: 26,450,682	V202E	probably damaging	Het
Slc1a6	A	G	10: 78,793,307	N186S	probably damaging	Het
Soga1	G	A	2: 157,023,817	Q1127*	probably null	Het
Sorbs3	G	A	14: 70,184,896	R622*	probably null	Het
Spag9	C	A	11: 94,069,012	D342E	probably damaging	Het
Srgap3	T	C	6: 112,766,939	Y446C	probably damaging	Het
Thsd7b	C	T	1: 129,678,243	R574*	probably null	Het
Tmem74	A	T	15: 43,866,821	Y275*	probably null	Het
Topors	A	T	4: 40,262,541	S248T	possibly damaging	Het
Ttn	T	A	2: 76,718,183	Y30179F	possibly damaging	Het
Ugt2b34	A	T	5: 86,892,865	F399L	probably damaging	Het
Ush2a	A	T	1: 188,356,798	I317F	probably damaging	Het
Usp1	T	C	4: 98,934,618	V723A	probably benign	Het
Usp34	T	G	11: 23,343,616	L237V	probably damaging	Het
Vgf	A	T	5: 137,032,286	D434V	probably damaging	Het
Vmn1r179	A	G	7: 23,928,675	N97S	probably benign	Het
Vps13a	A	G	19: 16,710,387	L899P	possibly damaging	Het
Vps33b	A	T	7: 80,274,253	I41F	probably damaging	Het
Zap70	A	T	1: 36,778,218	H210L	probably damaging	Het
Zc3h8	T	C	2: 128,928,915	D300G	probably benign	Het
Zfp958	C	A	8: 4,626,196	H55N	possibly damaging	Het

Other mutations in Trpm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Trpm1	APN	7	64243450	missense	probably damaging	1.00
IGL00465:Trpm1	APN	7	64247467	missense	possibly damaging	0.94
IGL01118:Trpm1	APN	7	64235824	missense	probably benign	0.24
IGL01148:Trpm1	APN	7	64243564	missense	probably damaging	1.00
IGL01303:Trpm1	APN	7	64210830	critical splice acceptor site	probably benign	0.00
IGL01432:Trpm1	APN	7	64235019	missense	probably benign	0.18
IGL01433:Trpm1	APN	7	64204528	missense	probably damaging	1.00
IGL01506:Trpm1	APN	7	64243581	missense	probably damaging	1.00
IGL01626:Trpm1	APN	7	64268889	missense	probably damaging	1.00
IGL01640:Trpm1	APN	7	64226897	missense	probably damaging	1.00
IGL01899:Trpm1	APN	7	64234994	missense	probably benign	0.24
IGL01959:Trpm1	APN	7	64208975	missense	possibly damaging	0.81
IGL02210:Trpm1	APN	7	64210865	missense	probably damaging	1.00
IGL02268:Trpm1	APN	7	64217614	missense	probably damaging	0.96
IGL02331:Trpm1	APN	7	64235052	missense	probably benign	0.30
IGL02334:Trpm1	APN	7	64245942	critical splice acceptor site	probably null
IGL02407:Trpm1	APN	7	64219121	missense	probably damaging	1.00
IGL02425:Trpm1	APN	7	64240427	missense	probably damaging	0.96
IGL02485:Trpm1	APN	7	64269114	missense	possibly damaging	0.52
IGL02635:Trpm1	APN	7	64199224	missense	probably benign	0.00
IGL02640:Trpm1	APN	7	64219133	missense	probably damaging	0.97
IGL02827:Trpm1	APN	7	64219160	missense	probably null	1.00
PIT4458001:Trpm1	UTSW	7	64268561	missense	possibly damaging	0.94
PIT4544001:Trpm1	UTSW	7	64199250	intron	probably benign
R0012:Trpm1	UTSW	7	64268591	missense	possibly damaging	0.88
R0014:Trpm1	UTSW	7	64248222	missense	probably damaging	1.00
R0056:Trpm1	UTSW	7	64243586	missense	probably damaging	1.00
R0445:Trpm1	UTSW	7	64244842	unclassified	probably benign
R0463:Trpm1	UTSW	7	64220254	missense	probably benign	0.05
R0469:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R0510:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R1301:Trpm1	UTSW	7	64203053	splice site	probably null
R1397:Trpm1	UTSW	7	64217658	missense	probably damaging	1.00
R1588:Trpm1	UTSW	7	64223817	missense	possibly damaging	0.93
R1618:Trpm1	UTSW	7	64240535	missense	probably damaging	1.00
R1724:Trpm1	UTSW	7	64235821	nonsense	probably null
R1827:Trpm1	UTSW	7	64235007	missense	probably damaging	1.00
R1829:Trpm1	UTSW	7	64226782	missense	probably damaging	1.00
R1835:Trpm1	UTSW	7	64230268	missense	probably damaging	1.00
R1864:Trpm1	UTSW	7	64268016	missense	probably damaging	1.00
R1895:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1946:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1959:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1960:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1980:Trpm1	UTSW	7	64208434	missense	possibly damaging	0.83
R1989:Trpm1	UTSW	7	64209032	intron	probably null
R2054:Trpm1	UTSW	7	64240555	missense	possibly damaging	0.69
R2156:Trpm1	UTSW	7	64234988	missense	probably damaging	1.00
R2251:Trpm1	UTSW	7	64209976	missense	probably damaging	1.00
R3051:Trpm1	UTSW	7	64269101	missense	probably damaging	1.00
R3148:Trpm1	UTSW	7	64235012	missense	probably benign	0.00
R3195:Trpm1	UTSW	7	64199313	nonsense	probably null
R3615:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3616:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3623:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3624:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3721:Trpm1	UTSW	7	64217727	intron	probably benign
R3822:Trpm1	UTSW	7	64217703	intron	probably benign
R4441:Trpm1	UTSW	7	64201918	missense	probably damaging	1.00
R4490:Trpm1	UTSW	7	64208912	nonsense	probably null
R4666:Trpm1	UTSW	7	64203034	missense	probably damaging	1.00
R4701:Trpm1	UTSW	7	64243500	missense	probably damaging	1.00
R4781:Trpm1	UTSW	7	64235052	missense	probably benign	0.30
R4811:Trpm1	UTSW	7	64208306	missense	probably damaging	1.00
R5017:Trpm1	UTSW	7	64244832	unclassified	probably benign
R5030:Trpm1	UTSW	7	64235831	missense	probably damaging	1.00
R5195:Trpm1	UTSW	7	64237693	missense	possibly damaging	0.84
R5238:Trpm1	UTSW	7	64268954	missense	probably damaging	1.00
R5575:Trpm1	UTSW	7	64220270	missense	possibly damaging	0.95
R5613:Trpm1	UTSW	7	64208411	missense	probably damaging	1.00
R5855:Trpm1	UTSW	7	64268962	nonsense	probably null
R5947:Trpm1	UTSW	7	64223799	missense	probably benign	0.07
R5988:Trpm1	UTSW	7	64226805	missense	probably benign	0.16
R6054:Trpm1	UTSW	7	64268702	missense	probably benign	0.00
R6088:Trpm1	UTSW	7	64267976	missense	probably damaging	0.98
R6259:Trpm1	UTSW	7	64268478	missense	possibly damaging	0.47
R6379:Trpm1	UTSW	7	64199194	missense	probably benign	0.00
R6380:Trpm1	UTSW	7	64268297	missense	probably benign	0.24
R6429:Trpm1	UTSW	7	64268504	missense	probably benign	0.00
R6600:Trpm1	UTSW	7	64154033	start codon destroyed	probably null	0.56
R6622:Trpm1	UTSW	7	64240595	missense	probably damaging	0.96
R6939:Trpm1	UTSW	7	64268297	missense	probably benign	0.03
R6944:Trpm1	UTSW	7	64243433	missense	probably damaging	1.00
R7025:Trpm1	UTSW	7	64226714	critical splice acceptor site	probably null
R7112:Trpm1	UTSW	7	64235845	missense	probably damaging	0.97
R7168:Trpm1	UTSW	7	64268697	missense	probably benign	0.01
R7219:Trpm1	UTSW	7	64204585	missense	possibly damaging	0.68
R7224:Trpm1	UTSW	7	64219106	critical splice acceptor site	probably null
R7285:Trpm1	UTSW	7	64209981	nonsense	probably null
R7367:Trpm1	UTSW	7	64268801	missense	probably benign	0.06
R7449:Trpm1	UTSW	7	64208975	missense	probably benign	0.14
R7466:Trpm1	UTSW	7	64240582	missense	probably damaging	0.99
R7498:Trpm1	UTSW	7	64208909	missense	possibly damaging	0.93
R7581:Trpm1	UTSW	7	64204555	missense	probably benign	0.00
R7776:Trpm1	UTSW	7	64248191	missense	probably benign	0.04
R8062:Trpm1	UTSW	7	64201941	missense	probably benign	0.18
R8069:Trpm1	UTSW	7	64208970	missense	possibly damaging	0.55
R8157:Trpm1	UTSW	7	64199269	missense	probably damaging	1.00
R8219:Trpm1	UTSW	7	64201951	missense	probably benign	0.35
R8258:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8259:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8320:Trpm1	UTSW	7	64268793	missense	possibly damaging	0.56
R8536:Trpm1	UTSW	7	64247407	missense	probably damaging	1.00
R8544:Trpm1	UTSW	7	64224608	splice site	probably null
R8813:Trpm1	UTSW	7	64202008	missense	possibly damaging	0.68
R8912:Trpm1	UTSW	7	64268880	missense	probably benign	0.06
R8954:Trpm1	UTSW	7	64208341	missense	probably damaging	0.98
R9139:Trpm1	UTSW	7	64199195	missense	probably benign	0.00
R9205:Trpm1	UTSW	7	64240571	missense	possibly damaging	0.66
R9258:Trpm1	UTSW	7	64234965	missense	probably benign	0.01
R9283:Trpm1	UTSW	7	64223875	missense	probably benign	0.18
R9394:Trpm1	UTSW	7	64268732	missense	probably benign	0.00
R9430:Trpm1	UTSW	7	64223698	missense	probably benign	0.38
R9537:Trpm1	UTSW	7	64153868	unclassified	probably benign
R9616:Trpm1	UTSW	7	64208384	missense	probably damaging	0.99
R9774:Trpm1	UTSW	7	64248293	missense	possibly damaging	0.90
X0026:Trpm1	UTSW	7	64268910	missense	probably benign	0.05
Z1176:Trpm1	UTSW	7	64203131	critical splice donor site	probably null
Z1176:Trpm1	UTSW	7	64204594	critical splice donor site	probably null
Z1177:Trpm1	UTSW	7	64217691	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TCTCATCCATTAGCAGTCCAAAATC -3'
(R):5'- TTCCTTCAGGGTTGCACTGG -3'

Sequencing Primer
(F):5'- TCCAAAATCAAAAGTACTGGGTG -3'
(R):5'- GGGATGAGTTCATAAGCTGCC -3'

Posted On

2016-07-22