Incidental Mutation 'R5304:Mphosph10'
ID404432
Institutional Source Beutler Lab
Gene Symbol Mphosph10
Ensembl Gene ENSMUSG00000030521
Gene NameM-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)
Synonyms
MMRRC Submission 042887-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R5304 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location64376527-64392268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64388984 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 272 (F272L)
Ref Sequence ENSEMBL: ENSMUSP00000032735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032735] [ENSMUST00000037205] [ENSMUST00000206194] [ENSMUST00000206882]
Predicted Effect probably damaging
Transcript: ENSMUST00000032735
AA Change: F272L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032735
Gene: ENSMUSG00000030521
AA Change: F272L

DomainStartEndE-ValueType
Pfam:Mpp10 20 654 6.9e-217 PFAM
low complexity region 666 671 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000037205
SMART Domains Protein: ENSMUSP00000047855
Gene: ENSMUSG00000033429

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
Pfam:Glyoxalase 49 175 2.7e-14 PFAM
Pfam:Glyoxalase_3 50 166 5.1e-9 PFAM
Pfam:Glyoxalase_4 51 162 1.2e-20 PFAM
Pfam:Glyoxalase_2 55 175 1.9e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126727
AA Change: F427L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206047
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206138
Predicted Effect probably benign
Transcript: ENSMUST00000206194
Predicted Effect probably benign
Transcript: ENSMUST00000206882
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is phosphorylated during mitosis. The protein localizes to the nucleolus during interphase and to the chromosomes during M phase. The protein associates with the U3 small nucleolar ribonucleoprotein 60-80S complexes and may be involved in pre-rRNA processing. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A T 9: 22,424,232 T49S probably benign Het
Adcy1 C T 11: 7,064,198 A200V probably benign Het
Adgrv1 T C 13: 81,578,253 D551G possibly damaging Het
Aldh3a2 A G 11: 61,253,712 V340A probably damaging Het
Amy1 C A 3: 113,558,364 C393F probably damaging Het
Ankrd16 T C 2: 11,789,734 V310A probably benign Het
Arhgef15 T C 11: 68,947,237 S686G probably null Het
Arid4b T A 13: 14,186,929 N659K probably benign Het
Asz1 C T 6: 18,076,620 R191Q probably benign Het
Atp2a3 A G 11: 72,988,557 I947V probably damaging Het
AW011738 G A 4: 156,203,512 probably benign Het
Bfsp1 G T 2: 143,827,291 T456K probably benign Het
Cdc25c T C 18: 34,750,811 T40A possibly damaging Het
Cdh7 G A 1: 110,108,839 C583Y probably damaging Het
Cfap54 A T 10: 92,821,106 L3028Q probably damaging Het
Chd1 A G 17: 15,754,951 S1088G probably benign Het
Chd1 A T 17: 15,770,268 H1694L possibly damaging Het
Cstf3 G T 2: 104,663,390 E580* probably null Het
Dip2a A T 10: 76,294,523 M622K possibly damaging Het
Dlgap1 A T 17: 70,815,207 H877L probably damaging Het
Egfr G T 11: 16,884,260 M122I probably benign Het
Etfbkmt T A 6: 149,147,206 D114E probably damaging Het
Eva1c T C 16: 90,869,663 L158P probably damaging Het
Exo1 G A 1: 175,892,976 V287M probably damaging Het
Fam171a1 T C 2: 3,225,617 Y471H probably damaging Het
Fermt1 T A 2: 132,942,066 T8S probably benign Het
Fgfr2 G T 7: 130,167,774 P630T probably damaging Het
Fmo5 G A 3: 97,651,622 G466E probably damaging Het
Gm5155 A C 7: 17,902,692 E231D probably benign Het
Hcn4 A G 9: 58,843,932 I280M probably benign Het
Ifi208 A C 1: 173,683,608 K443T probably benign Het
Irs3 A G 5: 137,644,741 F145S probably benign Het
Kirrel T A 3: 87,089,595 H300L probably benign Het
Krit1 A G 5: 3,819,326 Q340R probably damaging Het
Lipo5 T C 19: 33,467,749 D140G unknown Het
Lrrtm4 A T 6: 80,022,700 Q365L probably benign Het
Lrwd1 G T 5: 136,131,150 T353K possibly damaging Het
Lsm14a A T 7: 34,353,729 S240R possibly damaging Het
Map3k5 A G 10: 20,108,238 I870V probably benign Het
Mmp17 A T 5: 129,594,614 E76V probably null Het
Myh10 A G 11: 68,764,245 K380R probably damaging Het
Myo3b C T 2: 70,426,888 P1282L probably damaging Het
Nemp2 T C 1: 52,643,079 probably benign Het
Ola1 T C 2: 73,199,434 I114V probably damaging Het
Olfr1066 T A 2: 86,455,435 T279S probably damaging Het
Olfr140 T A 2: 90,051,913 H137L probably benign Het
Pabpc4 T G 4: 123,290,307 D204E probably benign Het
Pigr A T 1: 130,849,493 M679L probably benign Het
Pik3c2b A T 1: 133,070,408 M341L possibly damaging Het
Plin4 T A 17: 56,106,132 T498S probably benign Het
Ppp2r5e A G 12: 75,515,685 S15P possibly damaging Het
Prdm13 T C 4: 21,678,984 Y502C probably damaging Het
Ptprk T C 10: 28,592,054 probably null Het
Rapgef6 T C 11: 54,657,374 S505P probably benign Het
Rgmb G T 17: 15,820,728 S199* probably null Het
Rgsl1 T C 1: 153,827,492 T173A probably damaging Het
Rhobtb1 G T 10: 69,269,912 K102N probably damaging Het
Ripor2 A T 13: 24,674,666 D147V probably damaging Het
Rsad2 A T 12: 26,450,682 V202E probably damaging Het
Slc1a6 A G 10: 78,793,307 N186S probably damaging Het
Soga1 G A 2: 157,023,817 Q1127* probably null Het
Sorbs3 G A 14: 70,184,896 R622* probably null Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Srgap3 T C 6: 112,766,939 Y446C probably damaging Het
Thsd7b C T 1: 129,678,243 R574* probably null Het
Tmem74 A T 15: 43,866,821 Y275* probably null Het
Topors A T 4: 40,262,541 S248T possibly damaging Het
Trpm1 A T 7: 64,208,946 Y239F probably benign Het
Ttn T A 2: 76,718,183 Y30179F possibly damaging Het
Ugt2b34 A T 5: 86,892,865 F399L probably damaging Het
Ush2a A T 1: 188,356,798 I317F probably damaging Het
Usp1 T C 4: 98,934,618 V723A probably benign Het
Usp34 T G 11: 23,343,616 L237V probably damaging Het
Vgf A T 5: 137,032,286 D434V probably damaging Het
Vmn1r179 A G 7: 23,928,675 N97S probably benign Het
Vps13a A G 19: 16,710,387 L899P possibly damaging Het
Vps33b A T 7: 80,274,253 I41F probably damaging Het
Zap70 A T 1: 36,778,218 H210L probably damaging Het
Zc3h8 T C 2: 128,928,915 D300G probably benign Het
Zfp958 C A 8: 4,626,196 H55N possibly damaging Het
Other mutations in Mphosph10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Mphosph10 APN 7 64389755 missense probably benign 0.00
IGL02113:Mphosph10 APN 7 64376807 unclassified probably benign
IGL02615:Mphosph10 APN 7 64381045 splice site probably benign
R0280:Mphosph10 UTSW 7 64376703 missense possibly damaging 0.92
R0372:Mphosph10 UTSW 7 64388855 unclassified probably benign
R0503:Mphosph10 UTSW 7 64389893 missense probably benign
R0548:Mphosph10 UTSW 7 64378800 missense probably benign 0.45
R1158:Mphosph10 UTSW 7 64388859 unclassified probably benign
R1271:Mphosph10 UTSW 7 64390084 splice site probably null
R1447:Mphosph10 UTSW 7 64380950 missense probably damaging 1.00
R1501:Mphosph10 UTSW 7 64389504 missense probably damaging 1.00
R1815:Mphosph10 UTSW 7 64392170 missense probably benign 0.05
R1900:Mphosph10 UTSW 7 64381028 missense possibly damaging 0.61
R1997:Mphosph10 UTSW 7 64387447 critical splice donor site probably null
R2058:Mphosph10 UTSW 7 64376751 missense probably damaging 1.00
R2059:Mphosph10 UTSW 7 64376751 missense probably damaging 1.00
R2292:Mphosph10 UTSW 7 64385771 missense probably damaging 1.00
R4658:Mphosph10 UTSW 7 64388974 splice site probably null
R4817:Mphosph10 UTSW 7 64392221 unclassified probably benign
R4968:Mphosph10 UTSW 7 64382908 missense probably damaging 1.00
R5121:Mphosph10 UTSW 7 64389596 missense probably damaging 1.00
R5187:Mphosph10 UTSW 7 64385820 missense possibly damaging 0.49
R5469:Mphosph10 UTSW 7 64389445 critical splice donor site probably null
R6179:Mphosph10 UTSW 7 64378781 missense possibly damaging 0.66
R6360:Mphosph10 UTSW 7 64389955 missense probably benign 0.00
R6632:Mphosph10 UTSW 7 64385819 missense probably damaging 1.00
R6996:Mphosph10 UTSW 7 64388921 missense probably benign 0.07
R8531:Mphosph10 UTSW 7 64384328 missense possibly damaging 0.66
R8844:Mphosph10 UTSW 7 64377339 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTGTTATGTATCTGACAACCTGAG -3'
(R):5'- GTGGTCAACTAGTTGCCAGTTTC -3'

Sequencing Primer
(F):5'- GAGAAATACCTTACAGCTCTGACTGG -3'
(R):5'- CCCTAATAACTATTTCTGGTGGGG -3'
Posted On2016-07-22