Incidental Mutation 'R5304:Hcn4'
ID404438
Institutional Source Beutler Lab
Gene Symbol Hcn4
Ensembl Gene ENSMUSG00000032338
Gene Namehyperpolarization-activated, cyclic nucleotide-gated K+ 4
Synonyms
MMRRC Submission 042887-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5304 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location58823412-58863175 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58843932 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 280 (I280M)
Ref Sequence ENSEMBL: ENSMUSP00000034889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034889]
Predicted Effect probably benign
Transcript: ENSMUST00000034889
AA Change: I280M

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000034889
Gene: ENSMUSG00000032338
AA Change: I280M

DomainStartEndE-ValueType
low complexity region 27 39 N/A INTRINSIC
low complexity region 43 59 N/A INTRINSIC
low complexity region 97 120 N/A INTRINSIC
low complexity region 150 184 N/A INTRINSIC
Pfam:Ion_trans_N 218 261 1.2e-23 PFAM
Pfam:Ion_trans 262 525 2.2e-25 PFAM
low complexity region 526 537 N/A INTRINSIC
Blast:cNMP 538 570 9e-13 BLAST
cNMP 595 708 2.27e-23 SMART
low complexity region 761 771 N/A INTRINSIC
low complexity region 775 796 N/A INTRINSIC
low complexity region 808 818 N/A INTRINSIC
low complexity region 831 856 N/A INTRINSIC
low complexity region 866 906 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 931 956 N/A INTRINSIC
low complexity region 960 987 N/A INTRINSIC
low complexity region 991 1004 N/A INTRINSIC
low complexity region 1021 1036 N/A INTRINSIC
low complexity region 1045 1073 N/A INTRINSIC
low complexity region 1123 1140 N/A INTRINSIC
low complexity region 1154 1164 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hyperpolarization-activated cyclic nucleotide-gated potassium channels. The encoded protein shows slow kinetics of activation and inactivation, and is necessary for the cardiac pacemaking process. This channel may also mediate responses to sour stimuli. Mutations in this gene have been linked to sick sinus syndrome 2, also known as atrial fibrillation with bradyarrhythmia or familial sinus bradycardia. Two pseudogenes have been identified on chromosome 15. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene experience embryonic lethality between E9.5 and E11.5. Conditional deletion in cardiac tissue results in severe bradycardia and death. Mice over-expressing the gene exhibit impaired firing rate in ORN, small olfactory bulb and reduced glomeruli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A T 9: 22,424,232 T49S probably benign Het
Adcy1 C T 11: 7,064,198 A200V probably benign Het
Adgrv1 T C 13: 81,578,253 D551G possibly damaging Het
Aldh3a2 A G 11: 61,253,712 V340A probably damaging Het
Amy1 C A 3: 113,558,364 C393F probably damaging Het
Ankrd16 T C 2: 11,789,734 V310A probably benign Het
Arhgef15 T C 11: 68,947,237 S686G probably null Het
Arid4b T A 13: 14,186,929 N659K probably benign Het
Asz1 C T 6: 18,076,620 R191Q probably benign Het
Atp2a3 A G 11: 72,988,557 I947V probably damaging Het
AW011738 G A 4: 156,203,512 probably benign Het
Bfsp1 G T 2: 143,827,291 T456K probably benign Het
Cdc25c T C 18: 34,750,811 T40A possibly damaging Het
Cdh7 G A 1: 110,108,839 C583Y probably damaging Het
Cfap54 A T 10: 92,821,106 L3028Q probably damaging Het
Chd1 A G 17: 15,754,951 S1088G probably benign Het
Chd1 A T 17: 15,770,268 H1694L possibly damaging Het
Cstf3 G T 2: 104,663,390 E580* probably null Het
Dip2a A T 10: 76,294,523 M622K possibly damaging Het
Dlgap1 A T 17: 70,815,207 H877L probably damaging Het
Egfr G T 11: 16,884,260 M122I probably benign Het
Etfbkmt T A 6: 149,147,206 D114E probably damaging Het
Eva1c T C 16: 90,869,663 L158P probably damaging Het
Exo1 G A 1: 175,892,976 V287M probably damaging Het
Fam171a1 T C 2: 3,225,617 Y471H probably damaging Het
Fermt1 T A 2: 132,942,066 T8S probably benign Het
Fgfr2 G T 7: 130,167,774 P630T probably damaging Het
Fmo5 G A 3: 97,651,622 G466E probably damaging Het
Gm5155 A C 7: 17,902,692 E231D probably benign Het
Ifi208 A C 1: 173,683,608 K443T probably benign Het
Irs3 A G 5: 137,644,741 F145S probably benign Het
Kirrel T A 3: 87,089,595 H300L probably benign Het
Krit1 A G 5: 3,819,326 Q340R probably damaging Het
Lipo5 T C 19: 33,467,749 D140G unknown Het
Lrrtm4 A T 6: 80,022,700 Q365L probably benign Het
Lrwd1 G T 5: 136,131,150 T353K possibly damaging Het
Lsm14a A T 7: 34,353,729 S240R possibly damaging Het
Map3k5 A G 10: 20,108,238 I870V probably benign Het
Mmp17 A T 5: 129,594,614 E76V probably null Het
Mphosph10 A G 7: 64,388,984 F272L probably damaging Het
Myh10 A G 11: 68,764,245 K380R probably damaging Het
Myo3b C T 2: 70,426,888 P1282L probably damaging Het
Nemp2 T C 1: 52,643,079 probably benign Het
Ola1 T C 2: 73,199,434 I114V probably damaging Het
Olfr1066 T A 2: 86,455,435 T279S probably damaging Het
Olfr140 T A 2: 90,051,913 H137L probably benign Het
Pabpc4 T G 4: 123,290,307 D204E probably benign Het
Pigr A T 1: 130,849,493 M679L probably benign Het
Pik3c2b A T 1: 133,070,408 M341L possibly damaging Het
Plin4 T A 17: 56,106,132 T498S probably benign Het
Ppp2r5e A G 12: 75,515,685 S15P possibly damaging Het
Prdm13 T C 4: 21,678,984 Y502C probably damaging Het
Ptprk T C 10: 28,592,054 probably null Het
Rapgef6 T C 11: 54,657,374 S505P probably benign Het
Rgmb G T 17: 15,820,728 S199* probably null Het
Rgsl1 T C 1: 153,827,492 T173A probably damaging Het
Rhobtb1 G T 10: 69,269,912 K102N probably damaging Het
Ripor2 A T 13: 24,674,666 D147V probably damaging Het
Rsad2 A T 12: 26,450,682 V202E probably damaging Het
Slc1a6 A G 10: 78,793,307 N186S probably damaging Het
Soga1 G A 2: 157,023,817 Q1127* probably null Het
Sorbs3 G A 14: 70,184,896 R622* probably null Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Srgap3 T C 6: 112,766,939 Y446C probably damaging Het
Thsd7b C T 1: 129,678,243 R574* probably null Het
Tmem74 A T 15: 43,866,821 Y275* probably null Het
Topors A T 4: 40,262,541 S248T possibly damaging Het
Trpm1 A T 7: 64,208,946 Y239F probably benign Het
Ttn T A 2: 76,718,183 Y30179F possibly damaging Het
Ugt2b34 A T 5: 86,892,865 F399L probably damaging Het
Ush2a A T 1: 188,356,798 I317F probably damaging Het
Usp1 T C 4: 98,934,618 V723A probably benign Het
Usp34 T G 11: 23,343,616 L237V probably damaging Het
Vgf A T 5: 137,032,286 D434V probably damaging Het
Vmn1r179 A G 7: 23,928,675 N97S probably benign Het
Vps13a A G 19: 16,710,387 L899P possibly damaging Het
Vps33b A T 7: 80,274,253 I41F probably damaging Het
Zap70 A T 1: 36,778,218 H210L probably damaging Het
Zc3h8 T C 2: 128,928,915 D300G probably benign Het
Zfp958 C A 8: 4,626,196 H55N possibly damaging Het
Other mutations in Hcn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Hcn4 APN 9 58860053 missense unknown
IGL00939:Hcn4 APN 9 58843927 missense probably benign 0.39
IGL01154:Hcn4 APN 9 58859079 missense unknown
IGL01408:Hcn4 APN 9 58859886 missense unknown
IGL02658:Hcn4 APN 9 58859465 missense unknown
IGL02877:Hcn4 APN 9 58859167 missense unknown
IGL03211:Hcn4 APN 9 58858151 missense unknown
PIT1430001:Hcn4 UTSW 9 58859550 missense unknown
R0049:Hcn4 UTSW 9 58860299 missense probably damaging 0.98
R0268:Hcn4 UTSW 9 58860162 missense unknown
R0812:Hcn4 UTSW 9 58823512 start codon destroyed probably null
R2121:Hcn4 UTSW 9 58824058 missense unknown
R3035:Hcn4 UTSW 9 58823680 missense unknown
R3715:Hcn4 UTSW 9 58844036 missense unknown
R3737:Hcn4 UTSW 9 58843889 missense probably benign 0.39
R3958:Hcn4 UTSW 9 58844048 missense unknown
R4035:Hcn4 UTSW 9 58843889 missense probably benign 0.39
R4393:Hcn4 UTSW 9 58844300 missense unknown
R4418:Hcn4 UTSW 9 58843895 missense probably benign 0.39
R4532:Hcn4 UTSW 9 58857798 missense unknown
R4765:Hcn4 UTSW 9 58857977 missense unknown
R4857:Hcn4 UTSW 9 58859570 missense unknown
R4967:Hcn4 UTSW 9 58859828 missense unknown
R5068:Hcn4 UTSW 9 58860021 missense unknown
R5253:Hcn4 UTSW 9 58824275 missense unknown
R5600:Hcn4 UTSW 9 58859293 splice site probably null
R6346:Hcn4 UTSW 9 58859044 missense unknown
R6575:Hcn4 UTSW 9 58824152 missense unknown
R6622:Hcn4 UTSW 9 58857727 missense unknown
R6967:Hcn4 UTSW 9 58823945 missense unknown
R7038:Hcn4 UTSW 9 58823584 missense unknown
R7054:Hcn4 UTSW 9 58855717 missense unknown
R7229:Hcn4 UTSW 9 58853399 missense unknown
R7407:Hcn4 UTSW 9 58859370 missense unknown
R7448:Hcn4 UTSW 9 58844299 missense unknown
R7531:Hcn4 UTSW 9 58860137 missense unknown
R7572:Hcn4 UTSW 9 58823780 missense unknown
R7680:Hcn4 UTSW 9 58860671 missense probably benign 0.08
R7915:Hcn4 UTSW 9 58823935 missense unknown
R7956:Hcn4 UTSW 9 58844173 missense unknown
R8146:Hcn4 UTSW 9 58823744 missense unknown
R8234:Hcn4 UTSW 9 58844150 missense unknown
R8421:Hcn4 UTSW 9 58858096 missense unknown
R8690:Hcn4 UTSW 9 58843910 missense probably benign 0.39
R8855:Hcn4 UTSW 9 58858104 missense unknown
R8884:Hcn4 UTSW 9 58853422 missense unknown
RF011:Hcn4 UTSW 9 58859915 missense unknown
X0009:Hcn4 UTSW 9 58860759 nonsense probably null
X0057:Hcn4 UTSW 9 58859368 missense unknown
Z1176:Hcn4 UTSW 9 58858148 missense unknown
Predicted Primers PCR Primer
(F):5'- GGTGAATGAGGAGTCTCTGC -3'
(R):5'- TACCACAAACCAGCTTTTCAGG -3'

Sequencing Primer
(F):5'- GAGTCTCTGCTTGTGTCATGCC -3'
(R):5'- ACAAACCAGCTTTTCAGGTACTTC -3'
Posted On2016-07-22