Incidental Mutation 'R5304:Dip2a'
ID404442
Institutional Source Beutler Lab
Gene Symbol Dip2a
Ensembl Gene ENSMUSG00000020231
Gene Namedisco interacting protein 2 homolog A
SynonymsKiaa0184-hp, 4931420H10Rik, Dip2
MMRRC Submission 042887-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5304 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location76259429-76345291 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76294523 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 622 (M622K)
Ref Sequence ENSEMBL: ENSMUSP00000101057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036033] [ENSMUST00000105417] [ENSMUST00000160048] [ENSMUST00000160442]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036033
AA Change: M622K

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000043710
Gene: ENSMUSG00000020231
AA Change: M622K

DomainStartEndE-ValueType
DMAP_binding 9 122 2.55e-35 SMART
low complexity region 173 208 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
Pfam:AMP-binding 330 806 4.3e-26 PFAM
Pfam:AMP-binding 982 1456 1.4e-52 PFAM
low complexity region 1487 1498 N/A INTRINSIC
low complexity region 1511 1532 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105417
AA Change: M622K

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101057
Gene: ENSMUSG00000020231
AA Change: M622K

DomainStartEndE-ValueType
DMAP_binding 9 122 2.55e-35 SMART
low complexity region 173 208 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
Pfam:AMP-binding 330 806 6.6e-28 PFAM
Pfam:AMP-binding 992 1466 7.3e-65 PFAM
low complexity region 1497 1508 N/A INTRINSIC
low complexity region 1521 1542 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160048
AA Change: M583K

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125184
Gene: ENSMUSG00000020231
AA Change: M583K

DomainStartEndE-ValueType
DMAP_binding 9 83 7.94e-23 SMART
low complexity region 134 169 N/A INTRINSIC
low complexity region 242 254 N/A INTRINSIC
Pfam:AMP-binding 291 767 5.3e-26 PFAM
Pfam:AMP-binding 943 1417 1.7e-52 PFAM
low complexity region 1448 1459 N/A INTRINSIC
low complexity region 1472 1493 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160442
SMART Domains Protein: ENSMUSP00000125744
Gene: ENSMUSG00000020231

DomainStartEndE-ValueType
low complexity region 37 48 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162766
Meta Mutation Damage Score 0.6682 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may be involved in axon patterning in the central nervous system. This gene is not highly expressed. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A T 9: 22,424,232 T49S probably benign Het
Adcy1 C T 11: 7,064,198 A200V probably benign Het
Adgrv1 T C 13: 81,578,253 D551G possibly damaging Het
Aldh3a2 A G 11: 61,253,712 V340A probably damaging Het
Amy1 C A 3: 113,558,364 C393F probably damaging Het
Ankrd16 T C 2: 11,789,734 V310A probably benign Het
Arhgef15 T C 11: 68,947,237 S686G probably null Het
Arid4b T A 13: 14,186,929 N659K probably benign Het
Asz1 C T 6: 18,076,620 R191Q probably benign Het
Atp2a3 A G 11: 72,988,557 I947V probably damaging Het
AW011738 G A 4: 156,203,512 probably benign Het
Bfsp1 G T 2: 143,827,291 T456K probably benign Het
Cdc25c T C 18: 34,750,811 T40A possibly damaging Het
Cdh7 G A 1: 110,108,839 C583Y probably damaging Het
Cfap54 A T 10: 92,821,106 L3028Q probably damaging Het
Chd1 A G 17: 15,754,951 S1088G probably benign Het
Chd1 A T 17: 15,770,268 H1694L possibly damaging Het
Cstf3 G T 2: 104,663,390 E580* probably null Het
Dlgap1 A T 17: 70,815,207 H877L probably damaging Het
Egfr G T 11: 16,884,260 M122I probably benign Het
Etfbkmt T A 6: 149,147,206 D114E probably damaging Het
Eva1c T C 16: 90,869,663 L158P probably damaging Het
Exo1 G A 1: 175,892,976 V287M probably damaging Het
Fam171a1 T C 2: 3,225,617 Y471H probably damaging Het
Fermt1 T A 2: 132,942,066 T8S probably benign Het
Fgfr2 G T 7: 130,167,774 P630T probably damaging Het
Fmo5 G A 3: 97,651,622 G466E probably damaging Het
Gm5155 A C 7: 17,902,692 E231D probably benign Het
Hcn4 A G 9: 58,843,932 I280M probably benign Het
Ifi208 A C 1: 173,683,608 K443T probably benign Het
Irs3 A G 5: 137,644,741 F145S probably benign Het
Kirrel T A 3: 87,089,595 H300L probably benign Het
Krit1 A G 5: 3,819,326 Q340R probably damaging Het
Lipo5 T C 19: 33,467,749 D140G unknown Het
Lrrtm4 A T 6: 80,022,700 Q365L probably benign Het
Lrwd1 G T 5: 136,131,150 T353K possibly damaging Het
Lsm14a A T 7: 34,353,729 S240R possibly damaging Het
Map3k5 A G 10: 20,108,238 I870V probably benign Het
Mmp17 A T 5: 129,594,614 E76V probably null Het
Mphosph10 A G 7: 64,388,984 F272L probably damaging Het
Myh10 A G 11: 68,764,245 K380R probably damaging Het
Myo3b C T 2: 70,426,888 P1282L probably damaging Het
Nemp2 T C 1: 52,643,079 probably benign Het
Ola1 T C 2: 73,199,434 I114V probably damaging Het
Olfr1066 T A 2: 86,455,435 T279S probably damaging Het
Olfr140 T A 2: 90,051,913 H137L probably benign Het
Pabpc4 T G 4: 123,290,307 D204E probably benign Het
Pigr A T 1: 130,849,493 M679L probably benign Het
Pik3c2b A T 1: 133,070,408 M341L possibly damaging Het
Plin4 T A 17: 56,106,132 T498S probably benign Het
Ppp2r5e A G 12: 75,515,685 S15P possibly damaging Het
Prdm13 T C 4: 21,678,984 Y502C probably damaging Het
Ptprk T C 10: 28,592,054 probably null Het
Rapgef6 T C 11: 54,657,374 S505P probably benign Het
Rgmb G T 17: 15,820,728 S199* probably null Het
Rgsl1 T C 1: 153,827,492 T173A probably damaging Het
Rhobtb1 G T 10: 69,269,912 K102N probably damaging Het
Ripor2 A T 13: 24,674,666 D147V probably damaging Het
Rsad2 A T 12: 26,450,682 V202E probably damaging Het
Slc1a6 A G 10: 78,793,307 N186S probably damaging Het
Soga1 G A 2: 157,023,817 Q1127* probably null Het
Sorbs3 G A 14: 70,184,896 R622* probably null Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Srgap3 T C 6: 112,766,939 Y446C probably damaging Het
Thsd7b C T 1: 129,678,243 R574* probably null Het
Tmem74 A T 15: 43,866,821 Y275* probably null Het
Topors A T 4: 40,262,541 S248T possibly damaging Het
Trpm1 A T 7: 64,208,946 Y239F probably benign Het
Ttn T A 2: 76,718,183 Y30179F possibly damaging Het
Ugt2b34 A T 5: 86,892,865 F399L probably damaging Het
Ush2a A T 1: 188,356,798 I317F probably damaging Het
Usp1 T C 4: 98,934,618 V723A probably benign Het
Usp34 T G 11: 23,343,616 L237V probably damaging Het
Vgf A T 5: 137,032,286 D434V probably damaging Het
Vmn1r179 A G 7: 23,928,675 N97S probably benign Het
Vps13a A G 19: 16,710,387 L899P possibly damaging Het
Vps33b A T 7: 80,274,253 I41F probably damaging Het
Zap70 A T 1: 36,778,218 H210L probably damaging Het
Zc3h8 T C 2: 128,928,915 D300G probably benign Het
Zfp958 C A 8: 4,626,196 H55N possibly damaging Het
Other mutations in Dip2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Dip2a APN 10 76313236 missense probably benign
IGL00849:Dip2a APN 10 76292318 missense probably damaging 0.99
IGL01685:Dip2a APN 10 76327749 missense probably damaging 1.00
IGL01825:Dip2a APN 10 76272680 nonsense probably null
IGL02343:Dip2a APN 10 76319478 missense probably benign 0.00
IGL02437:Dip2a APN 10 76298267 missense probably benign 0.09
IGL02981:Dip2a APN 10 76276421 missense possibly damaging 0.84
IGL03122:Dip2a APN 10 76275046 missense probably benign 0.00
IGL03261:Dip2a APN 10 76305148 missense possibly damaging 0.80
R0369:Dip2a UTSW 10 76298787 missense probably damaging 1.00
R0522:Dip2a UTSW 10 76321531 missense probably benign 0.03
R0962:Dip2a UTSW 10 76292432 unclassified probably benign
R1164:Dip2a UTSW 10 76276397 missense possibly damaging 0.72
R1309:Dip2a UTSW 10 76279776 missense probably damaging 1.00
R1426:Dip2a UTSW 10 76279820 unclassified probably benign
R1636:Dip2a UTSW 10 76321578 missense probably benign 0.01
R1823:Dip2a UTSW 10 76278502 nonsense probably null
R1830:Dip2a UTSW 10 76317963 missense probably damaging 1.00
R1876:Dip2a UTSW 10 76318091 missense probably damaging 1.00
R2284:Dip2a UTSW 10 76313193 missense probably benign 0.01
R2369:Dip2a UTSW 10 76313196 missense probably benign
R4050:Dip2a UTSW 10 76278607 missense probably damaging 1.00
R4089:Dip2a UTSW 10 76278489 splice site probably null
R4231:Dip2a UTSW 10 76319470 missense probably damaging 1.00
R4715:Dip2a UTSW 10 76296406 missense probably benign 0.34
R4752:Dip2a UTSW 10 76276657 missense probably damaging 1.00
R4846:Dip2a UTSW 10 76321493 missense probably damaging 1.00
R4849:Dip2a UTSW 10 76294533 missense probably damaging 1.00
R4892:Dip2a UTSW 10 76280759 missense probably benign 0.02
R4998:Dip2a UTSW 10 76319556 nonsense probably null
R5068:Dip2a UTSW 10 76318043 missense possibly damaging 0.82
R5141:Dip2a UTSW 10 76270453 missense probably damaging 1.00
R5253:Dip2a UTSW 10 76299997 missense probably damaging 1.00
R5324:Dip2a UTSW 10 76296393 missense probably damaging 1.00
R5369:Dip2a UTSW 10 76292360 missense probably damaging 1.00
R6272:Dip2a UTSW 10 76286407 makesense probably null
R6884:Dip2a UTSW 10 76272532 critical splice donor site probably null
R7143:Dip2a UTSW 10 76297791 missense probably damaging 1.00
R7247:Dip2a UTSW 10 76272532 critical splice donor site probably null
R7252:Dip2a UTSW 10 76273202 missense not run
R7327:Dip2a UTSW 10 76272562 missense probably benign 0.41
R7334:Dip2a UTSW 10 76274246 missense possibly damaging 0.91
R7349:Dip2a UTSW 10 76285592 missense probably damaging 1.00
R7360:Dip2a UTSW 10 76278560 missense probably damaging 1.00
R7513:Dip2a UTSW 10 76313235 missense probably benign
Z1088:Dip2a UTSW 10 76285628 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GGACACTTATCAAAGTAGTGATGAAGC -3'
(R):5'- AGACAAGAGTGTGGTCCGTG -3'

Sequencing Primer
(F):5'- AGCTGAATTTTGTACAATAGGTTCC -3'
(R):5'- TGCCTCTGCACAGGATGAGTG -3'
Posted On2016-07-22