Mutagenetix > Incidental Mutations

Incidental Mutation 'R5304:Rapgef6'

404448

Institutional Source

Beutler Lab

Gene Symbol

Rapgef6

Ensembl Gene

ENSMUSG00000037533

Gene Name

Rap guanine nucleotide exchange factor (GEF) 6

Synonyms

PDZ-GEF2, Pdzgef2, C030018K18Rik, RA-GEF-2

MMRRC Submission

042887-MU

Accession Numbers

Genbank: NM_175258; MGI: 2384761

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5304 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

54522847-54699285 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 54657374 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 505 (S505P)

Ref Sequence

ENSEMBL: ENSMUSP00000104522 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094536] [ENSMUST00000101206] [ENSMUST00000102743] [ENSMUST00000108894] [ENSMUST00000207429]

Predicted Effect

probably benign
Transcript: ENSMUST00000094536
AA Change: S505P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000092114
Gene: ENSMUSG00000037533
AA Change: S505P

Domain	Start	End	E-Value	Type
cNMP	1	113	6.64e-7	SMART
RasGEFN	127	240	4.35e-33	SMART
PDZ	255	327	8.86e-16	SMART
low complexity region	409	420	N/A	INTRINSIC
RA	464	550	1.47e-20	SMART
RasGEF	571	853	3.88e-84	SMART
low complexity region	944	957	N/A	INTRINSIC
low complexity region	972	989	N/A	INTRINSIC
low complexity region	1016	1061	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000101206
AA Change: S790P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000098766
Gene: ENSMUSG00000037533
AA Change: S790P

Domain	Start	End	E-Value	Type
internal_repeat_1	10	82	1.45e-5	PROSPERO
low complexity region	187	205	N/A	INTRINSIC
low complexity region	231	239	N/A	INTRINSIC
cNMP	280	398	4.8e-13	SMART
RasGEFN	412	525	4.35e-33	SMART
PDZ	540	612	8.86e-16	SMART
low complexity region	694	705	N/A	INTRINSIC
RA	749	835	1.47e-20	SMART
RasGEF	856	1095	5.35e-87	SMART
low complexity region	1237	1250	N/A	INTRINSIC
low complexity region	1270	1293	N/A	INTRINSIC
low complexity region	1345	1364	N/A	INTRINSIC
low complexity region	1368	1380	N/A	INTRINSIC
low complexity region	1444	1452	N/A	INTRINSIC
low complexity region	1555	1568	N/A	INTRINSIC
low complexity region	1591	1604	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102743
AA Change: S790P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000099804
Gene: ENSMUSG00000037533
AA Change: S790P

Domain	Start	End	E-Value	Type
internal_repeat_1	10	82	1.42e-5	PROSPERO
low complexity region	187	205	N/A	INTRINSIC
low complexity region	231	239	N/A	INTRINSIC
cNMP	280	398	4.8e-13	SMART
RasGEFN	412	525	4.35e-33	SMART
PDZ	540	612	8.86e-16	SMART
low complexity region	694	705	N/A	INTRINSIC
RA	749	835	1.47e-20	SMART
RasGEF	856	1138	3.88e-84	SMART
low complexity region	1229	1242	N/A	INTRINSIC
low complexity region	1262	1285	N/A	INTRINSIC
low complexity region	1337	1356	N/A	INTRINSIC
low complexity region	1360	1372	N/A	INTRINSIC
low complexity region	1436	1444	N/A	INTRINSIC
low complexity region	1547	1560	N/A	INTRINSIC
low complexity region	1583	1596	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108894
AA Change: S505P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000104522
Gene: ENSMUSG00000037533
AA Change: S505P

Domain	Start	End	E-Value	Type
cNMP	1	113	6.64e-7	SMART
RasGEFN	127	240	4.35e-33	SMART
PDZ	255	327	8.86e-16	SMART
low complexity region	409	420	N/A	INTRINSIC
RA	464	550	1.47e-20	SMART
RasGEF	571	810	5.35e-87	SMART
low complexity region	952	965	N/A	INTRINSIC
low complexity region	980	997	N/A	INTRINSIC
low complexity region	1024	1069	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175600

Predicted Effect

probably benign
Transcript: ENSMUST00000207429
AA Change: S795P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

Meta Mutation Damage Score

0.0592

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 95.9%

Validation Efficiency

99% (87/88)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit an inlarged spleen, increased IgE and IgG levels and altered cytokine production. [provided by MGI curators]

Allele List at MGI

All alleles(16) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(13)

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530077C05Rik	A	T	9: 22,424,232	T49S	probably benign	Het
Adcy1	C	T	11: 7,064,198	A200V	probably benign	Het
Adgrv1	T	C	13: 81,578,253	D551G	possibly damaging	Het
Aldh3a2	A	G	11: 61,253,712	V340A	probably damaging	Het
Amy1	C	A	3: 113,558,364	C393F	probably damaging	Het
Ankrd16	T	C	2: 11,789,734	V310A	probably benign	Het
Arhgef15	T	C	11: 68,947,237	S686G	probably null	Het
Arid4b	T	A	13: 14,186,929	N659K	probably benign	Het
Asz1	C	T	6: 18,076,620	R191Q	probably benign	Het
Atp2a3	A	G	11: 72,988,557	I947V	probably damaging	Het
AW011738	G	A	4: 156,203,512		probably benign	Het
Bfsp1	G	T	2: 143,827,291	T456K	probably benign	Het
Cdc25c	T	C	18: 34,750,811	T40A	possibly damaging	Het
Cdh7	G	A	1: 110,108,839	C583Y	probably damaging	Het
Cfap54	A	T	10: 92,821,106	L3028Q	probably damaging	Het
Chd1	A	G	17: 15,754,951	S1088G	probably benign	Het
Chd1	A	T	17: 15,770,268	H1694L	possibly damaging	Het
Cstf3	G	T	2: 104,663,390	E580*	probably null	Het
Dip2a	A	T	10: 76,294,523	M622K	possibly damaging	Het
Dlgap1	A	T	17: 70,815,207	H877L	probably damaging	Het
Egfr	G	T	11: 16,884,260	M122I	probably benign	Het
Etfbkmt	T	A	6: 149,147,206	D114E	probably damaging	Het
Eva1c	T	C	16: 90,869,663	L158P	probably damaging	Het
Exo1	G	A	1: 175,892,976	V287M	probably damaging	Het
Fam171a1	T	C	2: 3,225,617	Y471H	probably damaging	Het
Fermt1	T	A	2: 132,942,066	T8S	probably benign	Het
Fgfr2	G	T	7: 130,167,774	P630T	probably damaging	Het
Fmo5	G	A	3: 97,651,622	G466E	probably damaging	Het
Gm5155	A	C	7: 17,902,692	E231D	probably benign	Het
Hcn4	A	G	9: 58,843,932	I280M	probably benign	Het
Ifi208	A	C	1: 173,683,608	K443T	probably benign	Het
Irs3	A	G	5: 137,644,741	F145S	probably benign	Het
Kirrel	T	A	3: 87,089,595	H300L	probably benign	Het
Krit1	A	G	5: 3,819,326	Q340R	probably damaging	Het
Lipo5	T	C	19: 33,467,749	D140G	unknown	Het
Lrrtm4	A	T	6: 80,022,700	Q365L	probably benign	Het
Lrwd1	G	T	5: 136,131,150	T353K	possibly damaging	Het
Lsm14a	A	T	7: 34,353,729	S240R	possibly damaging	Het
Map3k5	A	G	10: 20,108,238	I870V	probably benign	Het
Mmp17	A	T	5: 129,594,614	E76V	probably null	Het
Mphosph10	A	G	7: 64,388,984	F272L	probably damaging	Het
Myh10	A	G	11: 68,764,245	K380R	probably damaging	Het
Myo3b	C	T	2: 70,426,888	P1282L	probably damaging	Het
Nemp2	T	C	1: 52,643,079		probably benign	Het
Ola1	T	C	2: 73,199,434	I114V	probably damaging	Het
Olfr1066	T	A	2: 86,455,435	T279S	probably damaging	Het
Olfr140	T	A	2: 90,051,913	H137L	probably benign	Het
Pabpc4	T	G	4: 123,290,307	D204E	probably benign	Het
Pigr	A	T	1: 130,849,493	M679L	probably benign	Het
Pik3c2b	A	T	1: 133,070,408	M341L	possibly damaging	Het
Plin4	T	A	17: 56,106,132	T498S	probably benign	Het
Ppp2r5e	A	G	12: 75,515,685	S15P	possibly damaging	Het
Prdm13	T	C	4: 21,678,984	Y502C	probably damaging	Het
Ptprk	T	C	10: 28,592,054		probably null	Het
Rgmb	G	T	17: 15,820,728	S199*	probably null	Het
Rgsl1	T	C	1: 153,827,492	T173A	probably damaging	Het
Rhobtb1	G	T	10: 69,269,912	K102N	probably damaging	Het
Ripor2	A	T	13: 24,674,666	D147V	probably damaging	Het
Rsad2	A	T	12: 26,450,682	V202E	probably damaging	Het
Slc1a6	A	G	10: 78,793,307	N186S	probably damaging	Het
Soga1	G	A	2: 157,023,817	Q1127*	probably null	Het
Sorbs3	G	A	14: 70,184,896	R622*	probably null	Het
Spag9	C	A	11: 94,069,012	D342E	probably damaging	Het
Srgap3	T	C	6: 112,766,939	Y446C	probably damaging	Het
Thsd7b	C	T	1: 129,678,243	R574*	probably null	Het
Tmem74	A	T	15: 43,866,821	Y275*	probably null	Het
Topors	A	T	4: 40,262,541	S248T	possibly damaging	Het
Trpm1	A	T	7: 64,208,946	Y239F	probably benign	Het
Ttn	T	A	2: 76,718,183	Y30179F	possibly damaging	Het
Ugt2b34	A	T	5: 86,892,865	F399L	probably damaging	Het
Ush2a	A	T	1: 188,356,798	I317F	probably damaging	Het
Usp1	T	C	4: 98,934,618	V723A	probably benign	Het
Usp34	T	G	11: 23,343,616	L237V	probably damaging	Het
Vgf	A	T	5: 137,032,286	D434V	probably damaging	Het
Vmn1r179	A	G	7: 23,928,675	N97S	probably benign	Het
Vps13a	A	G	19: 16,710,387	L899P	possibly damaging	Het
Vps33b	A	T	7: 80,274,253	I41F	probably damaging	Het
Zap70	A	T	1: 36,778,218	H210L	probably damaging	Het
Zc3h8	T	C	2: 128,928,915	D300G	probably benign	Het
Zfp958	C	A	8: 4,626,196	H55N	possibly damaging	Het

Other mutations in Rapgef6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00436:Rapgef6	APN	11	54679265	missense	probably benign	0.00
IGL00507:Rapgef6	APN	11	54664109	nonsense	probably null
IGL00809:Rapgef6	APN	11	54649300	missense	probably damaging	1.00
IGL00843:Rapgef6	APN	11	54691273	missense	probably benign	0.03
IGL00899:Rapgef6	APN	11	54620018	nonsense	probably null
IGL01372:Rapgef6	APN	11	54668611	splice site	probably benign
IGL01604:Rapgef6	APN	11	54694563	missense	probably damaging	0.99
IGL01935:Rapgef6	APN	11	54610842	missense	possibly damaging	0.78
IGL01991:Rapgef6	APN	11	54552869	missense	probably benign	0.37
IGL02243:Rapgef6	APN	11	54676400	missense	probably damaging	1.00
IGL02407:Rapgef6	APN	11	54676355	missense	possibly damaging	0.91
IGL02676:Rapgef6	APN	11	54649346	unclassified	probably benign
IGL02934:Rapgef6	APN	11	54625864	missense	probably damaging	1.00
IGL03076:Rapgef6	APN	11	54625967	missense	probably damaging	1.00
IGL03110:Rapgef6	APN	11	54696089	missense	probably damaging	0.97
IGL03256:Rapgef6	APN	11	54657429	missense	probably damaging	1.00
shocker	UTSW	11	54620016	missense	probably damaging	1.00
D4216:Rapgef6	UTSW	11	54668746	splice site	probably benign
PIT4305001:Rapgef6	UTSW	11	54679377	missense	probably damaging	1.00
PIT4366001:Rapgef6	UTSW	11	54691620	missense	probably damaging	0.98
R0047:Rapgef6	UTSW	11	54546378	missense	possibly damaging	0.65
R0047:Rapgef6	UTSW	11	54546378	missense	possibly damaging	0.65
R0125:Rapgef6	UTSW	11	54625875	nonsense	probably null
R0189:Rapgef6	UTSW	11	54691249	missense	probably benign
R0201:Rapgef6	UTSW	11	54619941	missense	probably damaging	1.00
R0505:Rapgef6	UTSW	11	54625963	missense	probably benign	0.00
R0524:Rapgef6	UTSW	11	54690284	missense	probably benign	0.32
R0853:Rapgef6	UTSW	11	54668677	missense	probably damaging	1.00
R1203:Rapgef6	UTSW	11	54691699	missense	probably benign	0.09
R1440:Rapgef6	UTSW	11	54626708	missense	probably damaging	1.00
R1453:Rapgef6	UTSW	11	54639727	splice site	probably null
R1530:Rapgef6	UTSW	11	54661183	missense	probably damaging	1.00
R1593:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1620:Rapgef6	UTSW	11	54626594	missense	possibly damaging	0.88
R1628:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1629:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1630:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1634:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1640:Rapgef6	UTSW	11	54657405	missense	probably damaging	1.00
R1686:Rapgef6	UTSW	11	54691632	missense	possibly damaging	0.81
R1722:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1743:Rapgef6	UTSW	11	54676284	missense	probably damaging	1.00
R1816:Rapgef6	UTSW	11	54694488	missense	probably benign
R1851:Rapgef6	UTSW	11	54642811	missense	probably benign	0.01
R1852:Rapgef6	UTSW	11	54642811	missense	probably benign	0.01
R1868:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1888:Rapgef6	UTSW	11	54660828	missense	probably damaging	1.00
R1888:Rapgef6	UTSW	11	54660828	missense	probably damaging	1.00
R1942:Rapgef6	UTSW	11	54657263	missense	possibly damaging	0.95
R1943:Rapgef6	UTSW	11	54657263	missense	possibly damaging	0.95
R2031:Rapgef6	UTSW	11	54552858	missense	probably benign	0.30
R2087:Rapgef6	UTSW	11	54631249	missense	probably damaging	1.00
R2106:Rapgef6	UTSW	11	54668686	missense	probably benign	0.17
R2362:Rapgef6	UTSW	11	54694272	missense	probably damaging	1.00
R2484:Rapgef6	UTSW	11	54642756	missense	possibly damaging	0.48
R2566:Rapgef6	UTSW	11	54687711	missense	possibly damaging	0.66
R2872:Rapgef6	UTSW	11	54661175	missense	probably damaging	1.00
R2872:Rapgef6	UTSW	11	54661175	missense	probably damaging	1.00
R3744:Rapgef6	UTSW	11	54625934	missense	probably benign	0.40
R3848:Rapgef6	UTSW	11	54691308	missense	probably damaging	0.97
R4823:Rapgef6	UTSW	11	54694500	missense	probably benign	0.08
R4859:Rapgef6	UTSW	11	54636163	missense	probably benign
R4906:Rapgef6	UTSW	11	54552836	missense	probably damaging	1.00
R4911:Rapgef6	UTSW	11	54622317	missense	probably damaging	0.97
R4937:Rapgef6	UTSW	11	54657317	missense	probably damaging	1.00
R5033:Rapgef6	UTSW	11	54691381	missense	possibly damaging	0.92
R5249:Rapgef6	UTSW	11	54523117	missense	probably benign	0.19
R5656:Rapgef6	UTSW	11	54636136	missense	possibly damaging	0.95
R5701:Rapgef6	UTSW	11	54676394	missense	possibly damaging	0.76
R5758:Rapgef6	UTSW	11	54668644	missense	probably damaging	1.00
R5973:Rapgef6	UTSW	11	54639783	missense	probably damaging	1.00
R6177:Rapgef6	UTSW	11	54620016	missense	probably damaging	1.00
R6268:Rapgef6	UTSW	11	54649247	missense	probably damaging	1.00
R6287:Rapgef6	UTSW	11	54626338	splice site	probably null
R6293:Rapgef6	UTSW	11	54634781	missense	probably damaging	1.00
R6471:Rapgef6	UTSW	11	54691737	missense	probably damaging	0.99
R6863:Rapgef6	UTSW	11	54546380	missense	probably benign	0.00
R6950:Rapgef6	UTSW	11	54676380	missense	probably benign	0.09
R7144:Rapgef6	UTSW	11	54657365	missense	possibly damaging	0.78
R7171:Rapgef6	UTSW	11	54676363	missense	possibly damaging	0.94
R7199:Rapgef6	UTSW	11	54546426	missense	probably benign	0.00
R7291:Rapgef6	UTSW	11	54691239	missense	probably benign	0.05
R7436:Rapgef6	UTSW	11	54610921	critical splice donor site	probably null
R7498:Rapgef6	UTSW	11	54620004	missense	probably damaging	1.00
R7506:Rapgef6	UTSW	11	54636171	missense	probably benign	0.00
R7527:Rapgef6	UTSW	11	54634961	missense	unknown
R7646:Rapgef6	UTSW	11	54625954	missense	probably benign	0.00
R7655:Rapgef6	UTSW	11	54694453	missense	probably benign	0.10
R7656:Rapgef6	UTSW	11	54694453	missense	probably benign	0.10
R7687:Rapgef6	UTSW	11	54661075	missense	possibly damaging	0.93
R7768:Rapgef6	UTSW	11	54626588	missense	probably damaging	1.00
R7788:Rapgef6	UTSW	11	54694399	missense	probably damaging	1.00
R7890:Rapgef6	UTSW	11	54626723	missense	probably damaging	1.00
R8113:Rapgef6	UTSW	11	54625958	missense	probably benign	0.03
R8337:Rapgef6	UTSW	11	54631301	nonsense	probably null
R8393:Rapgef6	UTSW	11	54687661	missense	probably benign
R8465:Rapgef6	UTSW	11	54691482	missense	probably benign	0.00
R8492:Rapgef6	UTSW	11	54690237	missense	probably damaging	0.99
R8791:Rapgef6	UTSW	11	54568469	missense	probably benign	0.15
R8866:Rapgef6	UTSW	11	54552874	critical splice donor site	probably null
R8917:Rapgef6	UTSW	11	54691566	nonsense	probably null
R8921:Rapgef6	UTSW	11	54679239	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- TGTAGAGGGGTCCTTGTACTCC -3'
(R):5'- TCCTAAAACACCCATTTTAACAGGG -3'

Sequencing Primer
(F):5'- CTTGTACTCCAAGTTGCTTTTGG -3'
(R):5'- TTTTAACAGGGAATCCACAAACAG -3'

Posted On

2016-07-22