Incidental Mutation 'R5304:Arhgef15'
ID404451
Institutional Source Beutler Lab
Gene Symbol Arhgef15
Ensembl Gene ENSMUSG00000052921
Gene NameRho guanine nucleotide exchange factor (GEF) 15
Synonyms
MMRRC Submission 042887-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5304 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location68943155-68957480 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 68947237 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 686 (S686G)
Ref Sequence ENSEMBL: ENSMUSP00000104311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065040] [ENSMUST00000108671]
Predicted Effect probably null
Transcript: ENSMUST00000065040
AA Change: S686G

PolyPhen 2 Score 0.324 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000067684
Gene: ENSMUSG00000052921
AA Change: S686G

DomainStartEndE-ValueType
low complexity region 6 36 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
low complexity region 84 127 N/A INTRINSIC
low complexity region 202 221 N/A INTRINSIC
low complexity region 275 285 N/A INTRINSIC
low complexity region 335 349 N/A INTRINSIC
RhoGEF 429 608 1.76e-50 SMART
low complexity region 670 680 N/A INTRINSIC
Blast:RhoGEF 688 746 1e-22 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108670
Predicted Effect probably null
Transcript: ENSMUST00000108671
AA Change: S686G

PolyPhen 2 Score 0.324 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104311
Gene: ENSMUSG00000052921
AA Change: S686G

DomainStartEndE-ValueType
low complexity region 6 36 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
low complexity region 84 127 N/A INTRINSIC
low complexity region 202 221 N/A INTRINSIC
low complexity region 275 285 N/A INTRINSIC
low complexity region 335 349 N/A INTRINSIC
RhoGEF 429 608 1.76e-50 SMART
low complexity region 670 680 N/A INTRINSIC
Blast:RhoGEF 688 746 1e-22 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141747
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151520
Meta Mutation Damage Score 0.1168 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein-coupled receptors. This gene encodes a protein that functions as a specific guanine nucleotide exchange factor for RhoA. It also interacts with ephrin A4 in vascular smooth muscle cells. Two alternatively spliced transcripts variants that encode the same protein have been found for this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock out allele exhibit increased excitatory synapse formation. Mice homozygous for a knock-out allele exhibit delayed radial growth, sparse vasculature and empty baselment membrane sleeves in the retina. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A T 9: 22,424,232 T49S probably benign Het
Adcy1 C T 11: 7,064,198 A200V probably benign Het
Adgrv1 T C 13: 81,578,253 D551G possibly damaging Het
Aldh3a2 A G 11: 61,253,712 V340A probably damaging Het
Amy1 C A 3: 113,558,364 C393F probably damaging Het
Ankrd16 T C 2: 11,789,734 V310A probably benign Het
Arid4b T A 13: 14,186,929 N659K probably benign Het
Asz1 C T 6: 18,076,620 R191Q probably benign Het
Atp2a3 A G 11: 72,988,557 I947V probably damaging Het
AW011738 G A 4: 156,203,512 probably benign Het
Bfsp1 G T 2: 143,827,291 T456K probably benign Het
Cdc25c T C 18: 34,750,811 T40A possibly damaging Het
Cdh7 G A 1: 110,108,839 C583Y probably damaging Het
Cfap54 A T 10: 92,821,106 L3028Q probably damaging Het
Chd1 A G 17: 15,754,951 S1088G probably benign Het
Chd1 A T 17: 15,770,268 H1694L possibly damaging Het
Cstf3 G T 2: 104,663,390 E580* probably null Het
Dip2a A T 10: 76,294,523 M622K possibly damaging Het
Dlgap1 A T 17: 70,815,207 H877L probably damaging Het
Egfr G T 11: 16,884,260 M122I probably benign Het
Etfbkmt T A 6: 149,147,206 D114E probably damaging Het
Eva1c T C 16: 90,869,663 L158P probably damaging Het
Exo1 G A 1: 175,892,976 V287M probably damaging Het
Fam171a1 T C 2: 3,225,617 Y471H probably damaging Het
Fermt1 T A 2: 132,942,066 T8S probably benign Het
Fgfr2 G T 7: 130,167,774 P630T probably damaging Het
Fmo5 G A 3: 97,651,622 G466E probably damaging Het
Gm5155 A C 7: 17,902,692 E231D probably benign Het
Hcn4 A G 9: 58,843,932 I280M probably benign Het
Ifi208 A C 1: 173,683,608 K443T probably benign Het
Irs3 A G 5: 137,644,741 F145S probably benign Het
Kirrel T A 3: 87,089,595 H300L probably benign Het
Krit1 A G 5: 3,819,326 Q340R probably damaging Het
Lipo5 T C 19: 33,467,749 D140G unknown Het
Lrrtm4 A T 6: 80,022,700 Q365L probably benign Het
Lrwd1 G T 5: 136,131,150 T353K possibly damaging Het
Lsm14a A T 7: 34,353,729 S240R possibly damaging Het
Map3k5 A G 10: 20,108,238 I870V probably benign Het
Mmp17 A T 5: 129,594,614 E76V probably null Het
Mphosph10 A G 7: 64,388,984 F272L probably damaging Het
Myh10 A G 11: 68,764,245 K380R probably damaging Het
Myo3b C T 2: 70,426,888 P1282L probably damaging Het
Nemp2 T C 1: 52,643,079 probably benign Het
Ola1 T C 2: 73,199,434 I114V probably damaging Het
Olfr1066 T A 2: 86,455,435 T279S probably damaging Het
Olfr140 T A 2: 90,051,913 H137L probably benign Het
Pabpc4 T G 4: 123,290,307 D204E probably benign Het
Pigr A T 1: 130,849,493 M679L probably benign Het
Pik3c2b A T 1: 133,070,408 M341L possibly damaging Het
Plin4 T A 17: 56,106,132 T498S probably benign Het
Ppp2r5e A G 12: 75,515,685 S15P possibly damaging Het
Prdm13 T C 4: 21,678,984 Y502C probably damaging Het
Ptprk T C 10: 28,592,054 probably null Het
Rapgef6 T C 11: 54,657,374 S505P probably benign Het
Rgmb G T 17: 15,820,728 S199* probably null Het
Rgsl1 T C 1: 153,827,492 T173A probably damaging Het
Rhobtb1 G T 10: 69,269,912 K102N probably damaging Het
Ripor2 A T 13: 24,674,666 D147V probably damaging Het
Rsad2 A T 12: 26,450,682 V202E probably damaging Het
Slc1a6 A G 10: 78,793,307 N186S probably damaging Het
Soga1 G A 2: 157,023,817 Q1127* probably null Het
Sorbs3 G A 14: 70,184,896 R622* probably null Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Srgap3 T C 6: 112,766,939 Y446C probably damaging Het
Thsd7b C T 1: 129,678,243 R574* probably null Het
Tmem74 A T 15: 43,866,821 Y275* probably null Het
Topors A T 4: 40,262,541 S248T possibly damaging Het
Trpm1 A T 7: 64,208,946 Y239F probably benign Het
Ttn T A 2: 76,718,183 Y30179F possibly damaging Het
Ugt2b34 A T 5: 86,892,865 F399L probably damaging Het
Ush2a A T 1: 188,356,798 I317F probably damaging Het
Usp1 T C 4: 98,934,618 V723A probably benign Het
Usp34 T G 11: 23,343,616 L237V probably damaging Het
Vgf A T 5: 137,032,286 D434V probably damaging Het
Vmn1r179 A G 7: 23,928,675 N97S probably benign Het
Vps13a A G 19: 16,710,387 L899P possibly damaging Het
Vps33b A T 7: 80,274,253 I41F probably damaging Het
Zap70 A T 1: 36,778,218 H210L probably damaging Het
Zc3h8 T C 2: 128,928,915 D300G probably benign Het
Zfp958 C A 8: 4,626,196 H55N possibly damaging Het
Other mutations in Arhgef15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Arhgef15 APN 11 68954102 missense probably damaging 1.00
IGL02382:Arhgef15 APN 11 68954030 missense probably damaging 0.98
R0041:Arhgef15 UTSW 11 68954516 missense possibly damaging 0.92
R0208:Arhgef15 UTSW 11 68946373 missense probably benign 0.09
R0276:Arhgef15 UTSW 11 68953472 splice site probably benign
R0368:Arhgef15 UTSW 11 68954693 missense probably damaging 0.99
R0706:Arhgef15 UTSW 11 68954576 missense probably damaging 1.00
R1628:Arhgef15 UTSW 11 68944814 missense possibly damaging 0.86
R1966:Arhgef15 UTSW 11 68954675 missense probably damaging 1.00
R2105:Arhgef15 UTSW 11 68947681 splice site probably null
R2278:Arhgef15 UTSW 11 68951691 missense probably damaging 1.00
R4667:Arhgef15 UTSW 11 68954561 missense probably benign 0.00
R4836:Arhgef15 UTSW 11 68949925 intron probably benign
R4898:Arhgef15 UTSW 11 68951345 missense probably benign 0.00
R4966:Arhgef15 UTSW 11 68947317 missense probably benign 0.08
R5333:Arhgef15 UTSW 11 68947196 intron probably benign
R5546:Arhgef15 UTSW 11 68954051 missense probably benign 0.01
R5632:Arhgef15 UTSW 11 68954051 missense probably benign 0.01
R5707:Arhgef15 UTSW 11 68954715 missense probably damaging 0.98
R5839:Arhgef15 UTSW 11 68954156 missense probably benign 0.00
R5926:Arhgef15 UTSW 11 68951955 missense possibly damaging 0.76
R6376:Arhgef15 UTSW 11 68954970 missense unknown
R6429:Arhgef15 UTSW 11 68947796 missense probably damaging 1.00
R6526:Arhgef15 UTSW 11 68949994 missense probably damaging 1.00
R6749:Arhgef15 UTSW 11 68954557 missense probably damaging 0.99
R7460:Arhgef15 UTSW 11 68947035 missense probably damaging 1.00
R7529:Arhgef15 UTSW 11 68954022 missense probably damaging 1.00
R7598:Arhgef15 UTSW 11 68946410 missense probably damaging 1.00
R7767:Arhgef15 UTSW 11 68953847 missense probably damaging 0.99
X0067:Arhgef15 UTSW 11 68944830 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TTTCTATAGACGTGACTCACAGTG -3'
(R):5'- ATGCTACCCTGAGGCTAGAG -3'

Sequencing Primer
(F):5'- TCACAGTGAGGCCGCTTG -3'
(R):5'- GAGCATCTCTCTCTCTCTCTCTC -3'
Posted On2016-07-22