Incidental Mutation 'R5304:Atp2a3'
ID 404452
Institutional Source Beutler Lab
Gene Symbol Atp2a3
Ensembl Gene ENSMUSG00000020788
Gene Name ATPase, Ca++ transporting, ubiquitous
Synonyms Serca3
MMRRC Submission 042887-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.137) question?
Stock # R5304 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 72851995-72883869 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 72879383 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 947 (I947V)
Ref Sequence ENSEMBL: ENSMUSP00000104125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021142] [ENSMUST00000108484] [ENSMUST00000108485] [ENSMUST00000108486] [ENSMUST00000163326]
AlphaFold Q64518
Predicted Effect probably damaging
Transcript: ENSMUST00000021142
AA Change: I947V

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021142
Gene: ENSMUSG00000020788
AA Change: I947V

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 4.43e-12 SMART
Pfam:E1-E2_ATPase 92 340 3.1e-66 PFAM
Pfam:Hydrolase 345 715 5.2e-22 PFAM
Pfam:HAD 348 712 3e-19 PFAM
Pfam:Cation_ATPase 418 528 4.4e-23 PFAM
Pfam:Hydrolase_3 684 747 4.5e-8 PFAM
Pfam:Cation_ATPase_C 784 987 1.8e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108484
AA Change: I929V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000104124
Gene: ENSMUSG00000020788
AA Change: I929V

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 3.4e-16 SMART
Pfam:E1-E2_ATPase 93 341 8.9e-67 PFAM
Pfam:Hydrolase 345 697 8.1e-27 PFAM
Pfam:HAD 348 694 4.1e-14 PFAM
Pfam:Hydrolase_like2 418 528 2.1e-21 PFAM
Pfam:Hydrolase_3 666 729 2.6e-6 PFAM
transmembrane domain 742 764 N/A INTRINSIC
Pfam:Cation_ATPase_C 766 969 4.2e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108485
AA Change: I947V

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104125
Gene: ENSMUSG00000020788
AA Change: I947V

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 4.43e-12 SMART
Pfam:E1-E2_ATPase 93 341 1.1e-68 PFAM
Pfam:Hydrolase 345 715 2.7e-33 PFAM
Pfam:HAD 348 712 1.3e-17 PFAM
Pfam:Hydrolase_like2 418 528 2.2e-23 PFAM
Pfam:Hydrolase_3 684 747 1.8e-8 PFAM
Pfam:Cation_ATPase_C 784 987 2.6e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108486
AA Change: I929V

PolyPhen 2 Score 0.825 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104126
Gene: ENSMUSG00000020788
AA Change: I929V

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 4.43e-12 SMART
Pfam:E1-E2_ATPase 93 341 1.4e-68 PFAM
Pfam:Hydrolase 345 697 2.8e-28 PFAM
Pfam:HAD 348 694 1.1e-15 PFAM
Pfam:Hydrolase_like2 418 528 1.7e-23 PFAM
Pfam:Hydrolase_3 666 729 5.1e-8 PFAM
Pfam:Cation_ATPase_C 766 969 2.5e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163326
AA Change: I947V

PolyPhen 2 Score 0.628 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000127036
Gene: ENSMUSG00000020788
AA Change: I947V

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 4.43e-12 SMART
Pfam:E1-E2_ATPase 93 341 1.4e-68 PFAM
Pfam:Hydrolase 345 715 6.5e-33 PFAM
Pfam:HAD 348 712 2.5e-17 PFAM
Pfam:Hydrolase_like2 418 528 1.7e-23 PFAM
Pfam:Hydrolase_3 684 747 5.1e-8 PFAM
Pfam:Cation_ATPase_C 784 987 2.5e-48 PFAM
Meta Mutation Damage Score 0.5016 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the SERCA Ca(2+)-ATPases, which are intracellular pumps located in the sarcoplasmic or endoplasmic reticula of muscle cells. This enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol to the sarcoplasmic reticulum lumen, and is involved in calcium sequestration associated with muscular excitation and contraction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in reduced endothelial-dependent relaxation in the aorta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 C T 11: 7,014,198 (GRCm39) A200V probably benign Het
Adgrv1 T C 13: 81,726,372 (GRCm39) D551G possibly damaging Het
Aldh3a2 A G 11: 61,144,538 (GRCm39) V340A probably damaging Het
Amy1 C A 3: 113,352,013 (GRCm39) C393F probably damaging Het
Ankrd16 T C 2: 11,794,545 (GRCm39) V310A probably benign Het
Arhgef15 T C 11: 68,838,063 (GRCm39) S686G probably null Het
Arid4b T A 13: 14,361,514 (GRCm39) N659K probably benign Het
Asz1 C T 6: 18,076,619 (GRCm39) R191Q probably benign Het
AW011738 G A 4: 156,287,969 (GRCm39) probably benign Het
Bfsp1 G T 2: 143,669,211 (GRCm39) T456K probably benign Het
Cdc25c T C 18: 34,883,864 (GRCm39) T40A possibly damaging Het
Cdh20 G A 1: 110,036,569 (GRCm39) C583Y probably damaging Het
Ceacam23 A C 7: 17,636,617 (GRCm39) E231D probably benign Het
Cfap54 A T 10: 92,656,968 (GRCm39) L3028Q probably damaging Het
Chd1 A G 17: 15,975,213 (GRCm39) S1088G probably benign Het
Chd1 A T 17: 15,990,530 (GRCm39) H1694L possibly damaging Het
Cstf3 G T 2: 104,493,735 (GRCm39) E580* probably null Het
Dip2a A T 10: 76,130,357 (GRCm39) M622K possibly damaging Het
Dlgap1 A T 17: 71,122,202 (GRCm39) H877L probably damaging Het
Egfr G T 11: 16,834,260 (GRCm39) M122I probably benign Het
Etfbkmt T A 6: 149,048,704 (GRCm39) D114E probably damaging Het
Eva1c T C 16: 90,666,551 (GRCm39) L158P probably damaging Het
Exo1 G A 1: 175,720,542 (GRCm39) V287M probably damaging Het
Fam171a1 T C 2: 3,226,654 (GRCm39) Y471H probably damaging Het
Fermt1 T A 2: 132,783,986 (GRCm39) T8S probably benign Het
Fgfr2 G T 7: 129,769,504 (GRCm39) P630T probably damaging Het
Fmo5 G A 3: 97,558,938 (GRCm39) G466E probably damaging Het
Hcn4 A G 9: 58,751,215 (GRCm39) I280M probably benign Het
Ifi208 A C 1: 173,511,174 (GRCm39) K443T probably benign Het
Irs3 A G 5: 137,643,003 (GRCm39) F145S probably benign Het
Kirrel1 T A 3: 86,996,902 (GRCm39) H300L probably benign Het
Krit1 A G 5: 3,869,326 (GRCm39) Q340R probably damaging Het
Lipo5 T C 19: 33,445,149 (GRCm39) D140G unknown Het
Lrrtm4 A T 6: 79,999,683 (GRCm39) Q365L probably benign Het
Lrwd1 G T 5: 136,160,004 (GRCm39) T353K possibly damaging Het
Lsm14a A T 7: 34,053,154 (GRCm39) S240R possibly damaging Het
Map3k5 A G 10: 19,983,984 (GRCm39) I870V probably benign Het
Matcap2 A T 9: 22,335,528 (GRCm39) T49S probably benign Het
Mmp17 A T 5: 129,671,678 (GRCm39) E76V probably null Het
Mphosph10 A G 7: 64,038,732 (GRCm39) F272L probably damaging Het
Mtcl2 G A 2: 156,865,737 (GRCm39) Q1127* probably null Het
Myh10 A G 11: 68,655,071 (GRCm39) K380R probably damaging Het
Myo3b C T 2: 70,257,232 (GRCm39) P1282L probably damaging Het
Nemp2 T C 1: 52,682,238 (GRCm39) probably benign Het
Ola1 T C 2: 73,029,778 (GRCm39) I114V probably damaging Het
Or4c3d T A 2: 89,882,257 (GRCm39) H137L probably benign Het
Or8k28 T A 2: 86,285,779 (GRCm39) T279S probably damaging Het
Pabpc4 T G 4: 123,184,100 (GRCm39) D204E probably benign Het
Pigr A T 1: 130,777,230 (GRCm39) M679L probably benign Het
Pik3c2b A T 1: 132,998,146 (GRCm39) M341L possibly damaging Het
Plin4 T A 17: 56,413,132 (GRCm39) T498S probably benign Het
Ppp2r5e A G 12: 75,562,459 (GRCm39) S15P possibly damaging Het
Prdm13 T C 4: 21,678,984 (GRCm39) Y502C probably damaging Het
Ptprk T C 10: 28,468,050 (GRCm39) probably null Het
Rapgef6 T C 11: 54,548,200 (GRCm39) S505P probably benign Het
Rgmb G T 17: 16,040,990 (GRCm39) S199* probably null Het
Rgsl1 T C 1: 153,703,238 (GRCm39) T173A probably damaging Het
Rhobtb1 G T 10: 69,105,742 (GRCm39) K102N probably damaging Het
Ripor2 A T 13: 24,858,649 (GRCm39) D147V probably damaging Het
Rsad2 A T 12: 26,500,681 (GRCm39) V202E probably damaging Het
Slc1a6 A G 10: 78,629,141 (GRCm39) N186S probably damaging Het
Sorbs3 G A 14: 70,422,345 (GRCm39) R622* probably null Het
Spag9 C A 11: 93,959,838 (GRCm39) D342E probably damaging Het
Srgap3 T C 6: 112,743,900 (GRCm39) Y446C probably damaging Het
Thsd7b C T 1: 129,605,980 (GRCm39) R574* probably null Het
Tmem74 A T 15: 43,730,217 (GRCm39) Y275* probably null Het
Topors A T 4: 40,262,541 (GRCm39) S248T possibly damaging Het
Trpm1 A T 7: 63,858,694 (GRCm39) Y239F probably benign Het
Ttn T A 2: 76,548,527 (GRCm39) Y30179F possibly damaging Het
Ugt2b34 A T 5: 87,040,724 (GRCm39) F399L probably damaging Het
Ush2a A T 1: 188,088,995 (GRCm39) I317F probably damaging Het
Usp1 T C 4: 98,822,855 (GRCm39) V723A probably benign Het
Usp34 T G 11: 23,293,616 (GRCm39) L237V probably damaging Het
Vgf A T 5: 137,061,140 (GRCm39) D434V probably damaging Het
Vmn1r179 A G 7: 23,628,100 (GRCm39) N97S probably benign Het
Vps13a A G 19: 16,687,751 (GRCm39) L899P possibly damaging Het
Vps33b A T 7: 79,924,001 (GRCm39) I41F probably damaging Het
Zap70 A T 1: 36,817,299 (GRCm39) H210L probably damaging Het
Zc3h8 T C 2: 128,770,835 (GRCm39) D300G probably benign Het
Zfp958 C A 8: 4,676,196 (GRCm39) H55N possibly damaging Het
Other mutations in Atp2a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Atp2a3 APN 11 72,873,613 (GRCm39) missense probably damaging 0.98
IGL01141:Atp2a3 APN 11 72,873,491 (GRCm39) missense probably damaging 1.00
IGL01949:Atp2a3 APN 11 72,872,723 (GRCm39) missense probably damaging 1.00
IGL02267:Atp2a3 APN 11 72,878,810 (GRCm39) missense probably damaging 1.00
IGL02385:Atp2a3 APN 11 72,866,165 (GRCm39) missense probably benign 0.00
IGL02390:Atp2a3 APN 11 72,866,165 (GRCm39) missense probably benign 0.00
IGL02391:Atp2a3 APN 11 72,866,165 (GRCm39) missense probably benign 0.00
IGL02392:Atp2a3 APN 11 72,866,165 (GRCm39) missense probably benign 0.00
IGL02487:Atp2a3 APN 11 72,866,165 (GRCm39) missense probably benign 0.00
IGL02525:Atp2a3 APN 11 72,866,165 (GRCm39) missense probably benign 0.00
IGL02526:Atp2a3 APN 11 72,866,165 (GRCm39) missense probably benign 0.00
IGL02527:Atp2a3 APN 11 72,866,165 (GRCm39) missense probably benign 0.00
IGL02581:Atp2a3 APN 11 72,866,165 (GRCm39) missense probably benign 0.00
IGL02643:Atp2a3 APN 11 72,866,165 (GRCm39) missense probably benign 0.00
IGL02644:Atp2a3 APN 11 72,866,165 (GRCm39) missense probably benign 0.00
IGL02646:Atp2a3 APN 11 72,866,165 (GRCm39) missense probably benign 0.00
IGL02647:Atp2a3 APN 11 72,866,165 (GRCm39) missense probably benign 0.00
IGL02649:Atp2a3 APN 11 72,866,165 (GRCm39) missense probably benign 0.00
IGL02650:Atp2a3 APN 11 72,866,165 (GRCm39) missense probably benign 0.00
IGL02651:Atp2a3 APN 11 72,866,165 (GRCm39) missense probably benign 0.00
IGL02667:Atp2a3 APN 11 72,866,165 (GRCm39) missense probably benign 0.00
IGL02668:Atp2a3 APN 11 72,866,165 (GRCm39) missense probably benign 0.00
IGL02819:Atp2a3 APN 11 72,868,033 (GRCm39) missense probably damaging 1.00
IGL02888:Atp2a3 APN 11 72,867,954 (GRCm39) splice site probably benign
Aplomb UTSW 11 72,871,274 (GRCm39) missense probably damaging 1.00
flair UTSW 11 72,866,223 (GRCm39) missense probably damaging 1.00
panache UTSW 11 72,872,765 (GRCm39) missense probably damaging 1.00
R0193:Atp2a3 UTSW 11 72,863,046 (GRCm39) missense possibly damaging 0.57
R0357:Atp2a3 UTSW 11 72,861,757 (GRCm39) critical splice donor site probably null
R0376:Atp2a3 UTSW 11 72,873,528 (GRCm39) missense probably damaging 1.00
R0452:Atp2a3 UTSW 11 72,868,058 (GRCm39) splice site probably null
R0494:Atp2a3 UTSW 11 72,872,731 (GRCm39) missense probably damaging 1.00
R0588:Atp2a3 UTSW 11 72,863,850 (GRCm39) missense possibly damaging 0.79
R0674:Atp2a3 UTSW 11 72,872,711 (GRCm39) missense probably damaging 1.00
R1586:Atp2a3 UTSW 11 72,882,570 (GRCm39) missense probably damaging 0.98
R1666:Atp2a3 UTSW 11 72,869,633 (GRCm39) critical splice donor site probably null
R1994:Atp2a3 UTSW 11 72,866,240 (GRCm39) missense probably damaging 0.99
R2087:Atp2a3 UTSW 11 72,871,274 (GRCm39) missense probably damaging 1.00
R4675:Atp2a3 UTSW 11 72,872,623 (GRCm39) missense probably damaging 1.00
R4795:Atp2a3 UTSW 11 72,863,855 (GRCm39) missense probably benign 0.01
R4898:Atp2a3 UTSW 11 72,873,506 (GRCm39) missense probably damaging 1.00
R5083:Atp2a3 UTSW 11 72,873,652 (GRCm39) missense probably null 0.49
R5174:Atp2a3 UTSW 11 72,871,041 (GRCm39) missense probably damaging 1.00
R5266:Atp2a3 UTSW 11 72,866,223 (GRCm39) missense probably damaging 1.00
R5802:Atp2a3 UTSW 11 72,863,708 (GRCm39) missense probably damaging 1.00
R6107:Atp2a3 UTSW 11 72,879,287 (GRCm39) critical splice acceptor site probably null
R6157:Atp2a3 UTSW 11 72,871,442 (GRCm39) missense probably damaging 1.00
R6760:Atp2a3 UTSW 11 72,873,566 (GRCm39) missense probably damaging 1.00
R7406:Atp2a3 UTSW 11 72,869,576 (GRCm39) missense probably damaging 1.00
R8818:Atp2a3 UTSW 11 72,872,765 (GRCm39) missense probably damaging 1.00
R9376:Atp2a3 UTSW 11 72,863,290 (GRCm39) missense probably damaging 1.00
R9456:Atp2a3 UTSW 11 72,871,131 (GRCm39) missense probably benign 0.07
R9562:Atp2a3 UTSW 11 72,873,578 (GRCm39) missense probably damaging 1.00
R9608:Atp2a3 UTSW 11 72,879,866 (GRCm39) missense probably benign 0.40
Z1176:Atp2a3 UTSW 11 72,880,366 (GRCm39) missense probably benign
Z1176:Atp2a3 UTSW 11 72,871,448 (GRCm39) missense possibly damaging 0.96
Z1177:Atp2a3 UTSW 11 72,871,153 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CAGAAATATCCACCCTGGTTCTAC -3'
(R):5'- TTTCTGTCCCCTGAAGGTGG -3'

Sequencing Primer
(F):5'- TTCTACAACCAAGGTAGTGAGGTG -3'
(R):5'- TATCTGTGGAATGATGGCTAGACAC -3'
Posted On 2016-07-22