Incidental Mutation 'R5304:Ppp2r5e'
ID404456
Institutional Source Beutler Lab
Gene Symbol Ppp2r5e
Ensembl Gene ENSMUSG00000021051
Gene Nameprotein phosphatase 2, regulatory subunit B', epsilon
SynonymsB56beta, protein phosphatase 2A subunit beta, 4633401M22Rik
MMRRC Submission 042887-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5304 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location75450881-75596245 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75515685 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 15 (S15P)
Ref Sequence ENSEMBL: ENSMUSP00000151905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021447] [ENSMUST00000218012] [ENSMUST00000218716] [ENSMUST00000220035]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021447
AA Change: S91P

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000021447
Gene: ENSMUSG00000021051
AA Change: S91P

DomainStartEndE-ValueType
low complexity region 18 41 N/A INTRINSIC
Pfam:B56 48 453 3.2e-195 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218012
Predicted Effect possibly damaging
Transcript: ENSMUST00000218716
AA Change: S15P

PolyPhen 2 Score 0.747 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218930
Predicted Effect possibly damaging
Transcript: ENSMUST00000220035
AA Change: S91P

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.1255 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphatase 2A regulatory subunit B family. Protein phosphatase 2A is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes an epsilon isoform of the regulatory subunit B56 subfamily. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A T 9: 22,424,232 T49S probably benign Het
Adcy1 C T 11: 7,064,198 A200V probably benign Het
Adgrv1 T C 13: 81,578,253 D551G possibly damaging Het
Aldh3a2 A G 11: 61,253,712 V340A probably damaging Het
Amy1 C A 3: 113,558,364 C393F probably damaging Het
Ankrd16 T C 2: 11,789,734 V310A probably benign Het
Arhgef15 T C 11: 68,947,237 S686G probably null Het
Arid4b T A 13: 14,186,929 N659K probably benign Het
Asz1 C T 6: 18,076,620 R191Q probably benign Het
Atp2a3 A G 11: 72,988,557 I947V probably damaging Het
AW011738 G A 4: 156,203,512 probably benign Het
Bfsp1 G T 2: 143,827,291 T456K probably benign Het
Cdc25c T C 18: 34,750,811 T40A possibly damaging Het
Cdh7 G A 1: 110,108,839 C583Y probably damaging Het
Cfap54 A T 10: 92,821,106 L3028Q probably damaging Het
Chd1 A T 17: 15,770,268 H1694L possibly damaging Het
Chd1 A G 17: 15,754,951 S1088G probably benign Het
Cstf3 G T 2: 104,663,390 E580* probably null Het
Dip2a A T 10: 76,294,523 M622K possibly damaging Het
Dlgap1 A T 17: 70,815,207 H877L probably damaging Het
Egfr G T 11: 16,884,260 M122I probably benign Het
Etfbkmt T A 6: 149,147,206 D114E probably damaging Het
Eva1c T C 16: 90,869,663 L158P probably damaging Het
Exo1 G A 1: 175,892,976 V287M probably damaging Het
Fam171a1 T C 2: 3,225,617 Y471H probably damaging Het
Fermt1 T A 2: 132,942,066 T8S probably benign Het
Fgfr2 G T 7: 130,167,774 P630T probably damaging Het
Fmo5 G A 3: 97,651,622 G466E probably damaging Het
Gm5155 A C 7: 17,902,692 E231D probably benign Het
Hcn4 A G 9: 58,843,932 I280M probably benign Het
Ifi208 A C 1: 173,683,608 K443T probably benign Het
Irs3 A G 5: 137,644,741 F145S probably benign Het
Kirrel T A 3: 87,089,595 H300L probably benign Het
Krit1 A G 5: 3,819,326 Q340R probably damaging Het
Lipo5 T C 19: 33,467,749 D140G unknown Het
Lrrtm4 A T 6: 80,022,700 Q365L probably benign Het
Lrwd1 G T 5: 136,131,150 T353K possibly damaging Het
Lsm14a A T 7: 34,353,729 S240R possibly damaging Het
Map3k5 A G 10: 20,108,238 I870V probably benign Het
Mmp17 A T 5: 129,594,614 E76V probably null Het
Mphosph10 A G 7: 64,388,984 F272L probably damaging Het
Myh10 A G 11: 68,764,245 K380R probably damaging Het
Myo3b C T 2: 70,426,888 P1282L probably damaging Het
Nemp2 T C 1: 52,643,079 probably benign Het
Ola1 T C 2: 73,199,434 I114V probably damaging Het
Olfr1066 T A 2: 86,455,435 T279S probably damaging Het
Olfr140 T A 2: 90,051,913 H137L probably benign Het
Pabpc4 T G 4: 123,290,307 D204E probably benign Het
Pigr A T 1: 130,849,493 M679L probably benign Het
Pik3c2b A T 1: 133,070,408 M341L possibly damaging Het
Plin4 T A 17: 56,106,132 T498S probably benign Het
Prdm13 T C 4: 21,678,984 Y502C probably damaging Het
Ptprk T C 10: 28,592,054 probably null Het
Rapgef6 T C 11: 54,657,374 S505P probably benign Het
Rgmb G T 17: 15,820,728 S199* probably null Het
Rgsl1 T C 1: 153,827,492 T173A probably damaging Het
Rhobtb1 G T 10: 69,269,912 K102N probably damaging Het
Ripor2 A T 13: 24,674,666 D147V probably damaging Het
Rsad2 A T 12: 26,450,682 V202E probably damaging Het
Slc1a6 A G 10: 78,793,307 N186S probably damaging Het
Soga1 G A 2: 157,023,817 Q1127* probably null Het
Sorbs3 G A 14: 70,184,896 R622* probably null Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Srgap3 T C 6: 112,766,939 Y446C probably damaging Het
Thsd7b C T 1: 129,678,243 R574* probably null Het
Tmem74 A T 15: 43,866,821 Y275* probably null Het
Topors A T 4: 40,262,541 S248T possibly damaging Het
Trpm1 A T 7: 64,208,946 Y239F probably benign Het
Ttn T A 2: 76,718,183 Y30179F possibly damaging Het
Ugt2b34 A T 5: 86,892,865 F399L probably damaging Het
Ush2a A T 1: 188,356,798 I317F probably damaging Het
Usp1 T C 4: 98,934,618 V723A probably benign Het
Usp34 T G 11: 23,343,616 L237V probably damaging Het
Vgf A T 5: 137,032,286 D434V probably damaging Het
Vmn1r179 A G 7: 23,928,675 N97S probably benign Het
Vps13a A G 19: 16,710,387 L899P possibly damaging Het
Vps33b A T 7: 80,274,253 I41F probably damaging Het
Zap70 A T 1: 36,778,218 H210L probably damaging Het
Zc3h8 T C 2: 128,928,915 D300G probably benign Het
Zfp958 C A 8: 4,626,196 H55N possibly damaging Het
Other mutations in Ppp2r5e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02602:Ppp2r5e APN 12 75493439 missense probably damaging 1.00
IGL03398:Ppp2r5e APN 12 75462405 missense possibly damaging 0.73
IGL03402:Ppp2r5e APN 12 75464893 missense probably damaging 0.99
R0129:Ppp2r5e UTSW 12 75462390 missense probably damaging 1.00
R0466:Ppp2r5e UTSW 12 75462442 splice site probably benign
R0894:Ppp2r5e UTSW 12 75469567 missense probably damaging 1.00
R1452:Ppp2r5e UTSW 12 75469536 splice site probably benign
R1551:Ppp2r5e UTSW 12 75469567 missense probably damaging 1.00
R1614:Ppp2r5e UTSW 12 75469567 missense probably damaging 1.00
R1693:Ppp2r5e UTSW 12 75469567 missense probably damaging 1.00
R1844:Ppp2r5e UTSW 12 75469766 missense possibly damaging 0.81
R1864:Ppp2r5e UTSW 12 75469567 missense probably damaging 1.00
R1908:Ppp2r5e UTSW 12 75469567 missense probably damaging 1.00
R1909:Ppp2r5e UTSW 12 75469567 missense probably damaging 1.00
R1933:Ppp2r5e UTSW 12 75469567 missense probably damaging 1.00
R2181:Ppp2r5e UTSW 12 75462324 missense probably benign 0.08
R3084:Ppp2r5e UTSW 12 75468616 missense probably benign 0.23
R4212:Ppp2r5e UTSW 12 75469551 missense probably damaging 1.00
R4213:Ppp2r5e UTSW 12 75469551 missense probably damaging 1.00
R4680:Ppp2r5e UTSW 12 75469759 missense probably damaging 1.00
R4761:Ppp2r5e UTSW 12 75593261 missense possibly damaging 0.92
R5147:Ppp2r5e UTSW 12 75469770 missense probably damaging 0.96
R5262:Ppp2r5e UTSW 12 75593271 missense probably damaging 1.00
R5429:Ppp2r5e UTSW 12 75453763 missense probably damaging 0.99
R5439:Ppp2r5e UTSW 12 75493476 missense probably benign
R7225:Ppp2r5e UTSW 12 75468579 missense probably damaging 0.96
R7453:Ppp2r5e UTSW 12 75462342 missense probably damaging 0.99
R7558:Ppp2r5e UTSW 12 75464992 missense probably damaging 1.00
R8017:Ppp2r5e UTSW 12 75464929 missense probably damaging 1.00
R8019:Ppp2r5e UTSW 12 75464929 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAATCCTAGTGCTGCGCTG -3'
(R):5'- TCACAGAGAATTCCTGTTGCCTAG -3'

Sequencing Primer
(F):5'- TGGCATCTAGCTCTCAGGAG -3'
(R):5'- CCTGTTGCCTAGAAATTGATGACAG -3'
Posted On2016-07-22