Mutagenetix > Incidental Mutation

Incidental Mutation 'R0009:Tnr'

40446

Institutional Source

Beutler Lab

Gene Symbol

Tnr

Ensembl Gene

ENSMUSG00000015829

Gene Name

tenascin R

Synonyms

TN-R, janusin, restrictin, J1-tenascin

MMRRC Submission

038304-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0009 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

159523769-159931729 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 159852416 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Valine at position 320 (G320V)

Ref Sequence

ENSEMBL: ENSMUSP00000141553 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111669] [ENSMUST00000192069] [ENSMUST00000193325]

AlphaFold

Q8BYI9

Predicted Effect

probably damaging
Transcript: ENSMUST00000111669
AA Change: G320V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107298
Gene: ENSMUSG00000015829
AA Change: G320V

Domain	Start	End	E-Value	Type
EGF_like	203	231	3.87e1	SMART
EGF_like	234	262	3.16e1	SMART
EGF_like	265	293	2.8e1	SMART
EGF	296	324	2.43e1	SMART
FN3	326	404	4.77e-8	SMART
FN3	415	493	3.1e-7	SMART
FN3	504	583	2.01e-6	SMART
FN3	594	675	1.98e-5	SMART
FN3	686	763	3.29e-11	SMART
FN3	774	851	3.32e-7	SMART
FN3	864	942	3.73e-10	SMART
FN3	953	1031	2.28e-5	SMART
FN3	1041	1118	8.56e-10	SMART
FBG	1133	1343	2.69e-133	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000192069
AA Change: G320V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141553
Gene: ENSMUSG00000015829
AA Change: G320V

Domain	Start	End	E-Value	Type
EGF_like	203	231	3.87e1	SMART
EGF_like	234	262	3.16e1	SMART
EGF_like	265	293	2.8e1	SMART
EGF	296	324	2.43e1	SMART
FN3	326	404	4.77e-8	SMART
FN3	415	493	3.1e-7	SMART
FN3	504	583	2.01e-6	SMART
FN3	594	675	1.98e-5	SMART
FN3	686	763	3.29e-11	SMART
FN3	774	851	3.32e-7	SMART
FN3	864	942	3.73e-10	SMART
FN3	953	1031	2.28e-5	SMART
FN3	1041	1118	8.56e-10	SMART
FBG	1133	1343	2.69e-133	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000192457

Predicted Effect

probably benign
Transcript: ENSMUST00000193325

Meta Mutation Damage Score

0.7347

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.7%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tenascin family of extracellular matrix glycoproteins. The encoded protein is restricted to the central nervous system. The protein may play a role in neurite outgrowth, neural cell adhesion and modulation of sodium channel function. It is a constituent of perineuronal nets. [provided by RefSeq, Aug 2013]
PHENOTYPE: In spite of having decreased conduction velocity in the optic nerve and ultrastrucural alterations within the hippocampus, homozygous null mice are viable, fertile, and display normal behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A1bg	T	G	15: 60,919,633		probably benign	Het
Abcg4	T	G	9: 44,277,649		probably benign	Het
Afm	C	A	5: 90,545,384		probably benign	Het
Ahrr	G	A	13: 74,283,024		probably benign	Het
Aplnr	T	A	2: 85,137,276		probably null	Het
Arih2	T	A	9: 108,611,727	H264L	probably damaging	Het
Atp1a1	A	T	3: 101,579,835	I886N	possibly damaging	Het
Bmf	A	T	2: 118,549,622	V14E	probably damaging	Het
Ccdc116	T	C	16: 17,144,039	E15G	probably damaging	Het
Ccdc175	T	C	12: 72,135,965	N427D	possibly damaging	Het
Cfap53	A	G	18: 74,299,176	H45R	probably benign	Het
Chd3	A	G	11: 69,349,906	L1569P	probably damaging	Het
Cntn2	G	A	1: 132,516,180	Q457*	probably null	Het
Coro1a	A	T	7: 126,701,413		probably benign	Het
Cracr2b	T	A	7: 141,463,759	L91Q	probably damaging	Het
Ctdspl	T	C	9: 119,020,046		probably null	Het
Dip2b	T	A	15: 100,169,312	L565Q	probably damaging	Het
Dip2c	T	A	13: 9,621,903	C1004S	probably damaging	Het
Dnah11	A	T	12: 118,045,522	I2135N	possibly damaging	Het
Dnah14	A	G	1: 181,769,407		probably benign	Het
Dnase1	T	C	16: 4,038,946	V147A	probably damaging	Het
Dusp8	T	C	7: 142,082,054		probably benign	Het
Fer1l6	T	C	15: 58,662,787	Y1828H	probably damaging	Het
Flvcr1	A	G	1: 191,008,191	V544A	probably benign	Het
Fsd1l	T	C	4: 53,687,209	V311A	probably benign	Het
Glud1	G	A	14: 34,334,268	G300S	probably benign	Het
Gm4847	C	T	1: 166,630,486	V433I	probably benign	Het
Gstm3	T	G	3: 107,967,840	Y62S	probably damaging	Het
Gtse1	C	T	15: 85,862,435	P151S	probably benign	Het
Herc2	T	C	7: 56,207,812	S4048P	probably benign	Het
Hp1bp3	T	A	4: 138,221,683	I19K	probably benign	Het
Htr7	C	A	19: 36,041,540		probably benign	Het
Il1a	C	T	2: 129,309,074	D10N	probably damaging	Het
Il22ra2	A	T	10: 19,624,458	N39I	probably damaging	Het
Kcnn4	T	C	7: 24,379,255	C267R	possibly damaging	Het
Larp1	A	G	11: 58,055,473	K879R	possibly damaging	Het
Lcn5	T	A	2: 25,661,405		probably benign	Het
Lep	T	A	6: 29,068,972	C7*	probably null	Het
Magi2	A	T	5: 20,611,055	Y747F	probably benign	Het
Mast4	T	C	13: 102,742,058	T1223A	probably damaging	Het
Mcc	C	T	18: 44,445,933	E803K	probably damaging	Het
Mtmr4	T	C	11: 87,611,508	I796T	probably benign	Het
Myef2	A	T	2: 125,108,978	D312E	probably benign	Het
Myl3	A	C	9: 110,767,929	D119A	probably damaging	Het
Myo19	T	A	11: 84,888,169		probably null	Het
Naa15	T	G	3: 51,470,219	H763Q	probably damaging	Het
Pde5a	C	T	3: 122,824,902		probably benign	Het
Plpp2	C	T	10: 79,527,244	R184H	probably benign	Het
Rab19	T	G	6: 39,389,687	L179V	probably damaging	Het
Rims2	T	A	15: 39,534,966	M1087K	probably damaging	Het
Riox2	C	A	16: 59,489,367	D361E	probably benign	Het
Sh3rf1	T	A	8: 61,226,293	V123E	probably damaging	Het
Slc35e1	A	T	8: 72,484,709	N318K	probably damaging	Het
Slc9a2	A	T	1: 40,763,602	E604V	probably benign	Het
Srp72	T	C	5: 76,987,885	S221P	probably damaging	Het
Tbx19	A	T	1: 165,160,520	S15T	possibly damaging	Het
Tcea2	A	G	2: 181,685,817	T112A	probably benign	Het
Tesk1	T	A	4: 43,445,368	D230E	probably damaging	Het
Tm4sf5	C	T	11: 70,510,712	A179V	probably damaging	Het
Trappc11	A	T	8: 47,503,320	C874S	possibly damaging	Het
Trpm3	T	A	19: 22,914,446	Y885N	probably damaging	Het
Unc5a	T	A	13: 55,002,879	C505S	probably damaging	Het
Vmn1r28	G	A	6: 58,265,717	A182T	probably benign	Het
Xpo5	T	C	17: 46,204,786		probably benign	Het
Zfp637	C	A	6: 117,845,668	H252Q	probably damaging	Het
Zfp646	T	A	7: 127,880,731	D693E	probably damaging	Het

Other mutations in Tnr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00432:Tnr	APN	1	159861245	missense	probably benign	0.00
IGL00905:Tnr	APN	1	159852182	missense	probably benign	0.06
IGL01396:Tnr	APN	1	159897024	missense	possibly damaging	0.91
IGL01550:Tnr	APN	1	159874258	missense	probably benign
IGL01803:Tnr	APN	1	159868243	missense	probably damaging	1.00
IGL01845:Tnr	APN	1	159868006	unclassified	probably benign
IGL01983:Tnr	APN	1	159863779	missense	probably benign	0.00
IGL01985:Tnr	APN	1	159919037	missense	possibly damaging	0.70
IGL02210:Tnr	APN	1	159852101	missense	probably benign	0.44
IGL02486:Tnr	APN	1	159852094	splice site	probably null
IGL03210:Tnr	APN	1	159888310	missense	probably benign	0.00
Assiduous	UTSW	1	159892023	missense	probably benign
Grip	UTSW	1	159886110	missense	possibly damaging	0.68
Persistent	UTSW	1	159852286	missense	probably benign
Tenacious	UTSW	1	159874200	missense	probably damaging	1.00
R0002:Tnr	UTSW	1	159874200	missense	probably damaging	1.00
R0002:Tnr	UTSW	1	159874200	missense	probably damaging	1.00
R0042:Tnr	UTSW	1	159887025	missense	probably benign	0.01
R0594:Tnr	UTSW	1	159850335	missense	probably benign
R0617:Tnr	UTSW	1	159868103	missense	probably damaging	1.00
R0637:Tnr	UTSW	1	159850335	missense	possibly damaging	0.60
R0682:Tnr	UTSW	1	159852307	nonsense	probably null
R1171:Tnr	UTSW	1	159858210	missense	probably damaging	0.97
R1185:Tnr	UTSW	1	159852286	missense	probably benign
R1185:Tnr	UTSW	1	159852286	missense	probably benign
R1185:Tnr	UTSW	1	159852286	missense	probably benign
R1335:Tnr	UTSW	1	159868030	missense	probably benign	0.18
R1540:Tnr	UTSW	1	159850105	missense	probably damaging	0.99
R1697:Tnr	UTSW	1	159852030	missense	probably benign	0.00
R1938:Tnr	UTSW	1	159895037	nonsense	probably null
R1941:Tnr	UTSW	1	159850134	missense	possibly damaging	0.92
R2021:Tnr	UTSW	1	159852022	missense	probably benign
R2022:Tnr	UTSW	1	159852022	missense	probably benign
R2051:Tnr	UTSW	1	159892033	missense	probably benign
R2157:Tnr	UTSW	1	159858270	missense	probably damaging	0.98
R2319:Tnr	UTSW	1	159850048	start codon destroyed	probably null	1.00
R2936:Tnr	UTSW	1	159888362	missense	probably damaging	0.96
R3015:Tnr	UTSW	1	159888259	missense	probably benign	0.00
R3417:Tnr	UTSW	1	159895042	missense	probably benign	0.00
R3739:Tnr	UTSW	1	159923413	missense	possibly damaging	0.78
R3977:Tnr	UTSW	1	159892023	missense	probably benign
R4232:Tnr	UTSW	1	159886215	missense	possibly damaging	0.55
R4478:Tnr	UTSW	1	159884756	splice site	probably null
R4774:Tnr	UTSW	1	159897066	missense	probably damaging	1.00
R4829:Tnr	UTSW	1	159858404	missense	probably benign	0.24
R4837:Tnr	UTSW	1	159684788	intron	probably benign
R5111:Tnr	UTSW	1	159886228	missense	probably benign	0.04
R5224:Tnr	UTSW	1	159923315	missense	probably damaging	1.00
R5249:Tnr	UTSW	1	159684656	intron	probably benign
R5730:Tnr	UTSW	1	159888322	missense	probably benign	0.02
R5807:Tnr	UTSW	1	159886930	missense	possibly damaging	0.95
R5832:Tnr	UTSW	1	159886122	missense	probably benign	0.15
R5927:Tnr	UTSW	1	159912766	missense	probably damaging	1.00
R6049:Tnr	UTSW	1	159912754	missense	probably damaging	1.00
R6056:Tnr	UTSW	1	159886909	missense	probably damaging	0.99
R6063:Tnr	UTSW	1	159912684	missense	probably benign	0.00
R6141:Tnr	UTSW	1	159887122	missense	probably benign
R6218:Tnr	UTSW	1	159888314	missense	possibly damaging	0.94
R6275:Tnr	UTSW	1	159861270	missense	probably damaging	0.99
R6543:Tnr	UTSW	1	159924107	missense	probably damaging	1.00
R6626:Tnr	UTSW	1	159850252	missense	probably damaging	1.00
R7378:Tnr	UTSW	1	159884862	critical splice donor site	probably null
R7587:Tnr	UTSW	1	159886208	missense	probably benign	0.27
R7766:Tnr	UTSW	1	159888310	missense	probably benign	0.00
R8140:Tnr	UTSW	1	159863695	missense	probably damaging	0.99
R8215:Tnr	UTSW	1	159888290	missense	possibly damaging	0.91
R8248:Tnr	UTSW	1	159892093	missense	probably damaging	0.98
R8374:Tnr	UTSW	1	159858383	missense	probably benign	0.24
R8427:Tnr	UTSW	1	159886231	missense	possibly damaging	0.67
R8465:Tnr	UTSW	1	159886075	missense	probably benign	0.01
R8534:Tnr	UTSW	1	159919015	missense	probably benign	0.18
R8753:Tnr	UTSW	1	159850366	missense	probably benign	0.28
R8804:Tnr	UTSW	1	159858312	missense	probably benign
R8857:Tnr	UTSW	1	159886158	missense	probably benign	0.10
R8917:Tnr	UTSW	1	159874122	nonsense	probably null
R8930:Tnr	UTSW	1	159912789	missense	probably damaging	1.00
R8932:Tnr	UTSW	1	159912789	missense	probably damaging	1.00
R8940:Tnr	UTSW	1	159858297	missense	probably damaging	1.00
R9096:Tnr	UTSW	1	159850234	missense	probably benign	0.10
R9127:Tnr	UTSW	1	159886110	missense	possibly damaging	0.68
R9205:Tnr	UTSW	1	159895047	missense	probably benign
R9311:Tnr	UTSW	1	159850093	missense	probably benign	0.30
R9679:Tnr	UTSW	1	159892038	missense	probably benign	0.08
X0011:Tnr	UTSW	1	159889338	missense	probably benign	0.02
X0028:Tnr	UTSW	1	159874114	missense	probably damaging	1.00
Z1088:Tnr	UTSW	1	159895095	missense	probably benign	0.29
Z1177:Tnr	UTSW	1	159852091	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCATTTGTGACAGTGAATACAGCGG -3'
(R):5'- TTCTAGTCTCAGCGGTAGTGATCCAG -3'

Sequencing Primer
(F):5'- AATGTGTCTGTGAAGAGCCCTAC -3'
(R):5'- AGCGGTAGTGATCCAGATCTTATTC -3'

Posted On

2013-05-23