Mutagenetix > Incidental Mutation

Incidental Mutation 'R5304:Chd1'

404464

Institutional Source

Beutler Lab

Gene Symbol

Chd1

Ensembl Gene

ENSMUSG00000023852

Gene Name

chromodomain helicase DNA binding protein 1

Synonyms

4930525N21Rik

MMRRC Submission

042887-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5304 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

15704967-15772610 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 15754951 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 1088 (S1088G)

Ref Sequence

ENSEMBL: ENSMUSP00000024627 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024627] [ENSMUST00000173311]

AlphaFold

P40201

Predicted Effect

probably benign
Transcript: ENSMUST00000024627
AA Change: S1088G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000024627
Gene: ENSMUSG00000023852
AA Change: S1088G

Domain	Start	End	E-Value	Type
low complexity region	17	67	N/A	INTRINSIC
low complexity region	105	115	N/A	INTRINSIC
low complexity region	116	136	N/A	INTRINSIC
low complexity region	151	175	N/A	INTRINSIC
low complexity region	213	230	N/A	INTRINSIC
CHROMO	268	355	6.43e-20	SMART
CHROMO	385	443	1.19e-14	SMART
DEXDc	475	672	3.44e-34	SMART
Blast:DEXDc	692	786	2e-54	BLAST
low complexity region	787	799	N/A	INTRINSIC
HELICc	816	900	8.48e-25	SMART
Blast:DEXDc	955	1234	1e-112	BLAST
PDB:4B4C\|A	1119	1320	1e-132	PDB
low complexity region	1325	1348	N/A	INTRINSIC
low complexity region	1377	1388	N/A	INTRINSIC
DUF4208	1396	1500	5.54e-51	SMART
low complexity region	1507	1516	N/A	INTRINSIC
low complexity region	1538	1549	N/A	INTRINSIC
low complexity region	1626	1650	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000173040

SMART Domains

Protein: ENSMUSP00000133406
Gene: ENSMUSG00000023852

Domain	Start	End	E-Value	Type
Blast:DEXDc	2	102	5e-58	BLAST
PDB:4B4C\|A	2	153	1e-108	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000173311

SMART Domains

Protein: ENSMUSP00000134091
Gene: ENSMUSG00000023852

Domain	Start	End	E-Value	Type
low complexity region	17	67	N/A	INTRINSIC
low complexity region	105	115	N/A	INTRINSIC
low complexity region	116	136	N/A	INTRINSIC
low complexity region	151	175	N/A	INTRINSIC
low complexity region	213	230	N/A	INTRINSIC
CHROMO	268	355	6.43e-20	SMART
CHROMO	385	443	1.19e-14	SMART
DEXDc	475	672	3.44e-34	SMART
Blast:DEXDc	692	786	2e-54	BLAST
low complexity region	787	799	N/A	INTRINSIC
HELICc	816	900	8.48e-25	SMART
Blast:DEXDc	955	1078	2e-38	BLAST

Predicted Effect

unknown
Transcript: ENSMUST00000174461
AA Change: S472G

SMART Domains

Protein: ENSMUSP00000134718
Gene: ENSMUSG00000023852
AA Change: S472G

Domain	Start	End	E-Value	Type
Pfam:SNF2_N	1	148	3.6e-34	PFAM
low complexity region	172	184	N/A	INTRINSIC
HELICc	201	285	8.48e-25	SMART
Blast:DEXDc	340	516	1e-47	BLAST

Meta Mutation Damage Score

0.0584

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 95.9%

Validation Efficiency

99% (87/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with arrest of epiblast development due to increased apoptosis and cell cycle defects, abnormal rostral-caudal axis patterning, and failure to gastrulate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530077C05Rik	A	T	9: 22,424,232	T49S	probably benign	Het
Adcy1	C	T	11: 7,064,198	A200V	probably benign	Het
Adgrv1	T	C	13: 81,578,253	D551G	possibly damaging	Het
Aldh3a2	A	G	11: 61,253,712	V340A	probably damaging	Het
Amy1	C	A	3: 113,558,364	C393F	probably damaging	Het
Ankrd16	T	C	2: 11,789,734	V310A	probably benign	Het
Arhgef15	T	C	11: 68,947,237	S686G	probably null	Het
Arid4b	T	A	13: 14,186,929	N659K	probably benign	Het
Asz1	C	T	6: 18,076,620	R191Q	probably benign	Het
Atp2a3	A	G	11: 72,988,557	I947V	probably damaging	Het
AW011738	G	A	4: 156,203,512		probably benign	Het
Bfsp1	G	T	2: 143,827,291	T456K	probably benign	Het
Cdc25c	T	C	18: 34,750,811	T40A	possibly damaging	Het
Cdh7	G	A	1: 110,108,839	C583Y	probably damaging	Het
Cfap54	A	T	10: 92,821,106	L3028Q	probably damaging	Het
Cstf3	G	T	2: 104,663,390	E580*	probably null	Het
Dip2a	A	T	10: 76,294,523	M622K	possibly damaging	Het
Dlgap1	A	T	17: 70,815,207	H877L	probably damaging	Het
Egfr	G	T	11: 16,884,260	M122I	probably benign	Het
Etfbkmt	T	A	6: 149,147,206	D114E	probably damaging	Het
Eva1c	T	C	16: 90,869,663	L158P	probably damaging	Het
Exo1	G	A	1: 175,892,976	V287M	probably damaging	Het
Fam171a1	T	C	2: 3,225,617	Y471H	probably damaging	Het
Fermt1	T	A	2: 132,942,066	T8S	probably benign	Het
Fgfr2	G	T	7: 130,167,774	P630T	probably damaging	Het
Fmo5	G	A	3: 97,651,622	G466E	probably damaging	Het
Gm5155	A	C	7: 17,902,692	E231D	probably benign	Het
Hcn4	A	G	9: 58,843,932	I280M	probably benign	Het
Ifi208	A	C	1: 173,683,608	K443T	probably benign	Het
Irs3	A	G	5: 137,644,741	F145S	probably benign	Het
Kirrel	T	A	3: 87,089,595	H300L	probably benign	Het
Krit1	A	G	5: 3,819,326	Q340R	probably damaging	Het
Lipo5	T	C	19: 33,467,749	D140G	unknown	Het
Lrrtm4	A	T	6: 80,022,700	Q365L	probably benign	Het
Lrwd1	G	T	5: 136,131,150	T353K	possibly damaging	Het
Lsm14a	A	T	7: 34,353,729	S240R	possibly damaging	Het
Map3k5	A	G	10: 20,108,238	I870V	probably benign	Het
Mmp17	A	T	5: 129,594,614	E76V	probably null	Het
Mphosph10	A	G	7: 64,388,984	F272L	probably damaging	Het
Myh10	A	G	11: 68,764,245	K380R	probably damaging	Het
Myo3b	C	T	2: 70,426,888	P1282L	probably damaging	Het
Nemp2	T	C	1: 52,643,079		probably benign	Het
Ola1	T	C	2: 73,199,434	I114V	probably damaging	Het
Olfr1066	T	A	2: 86,455,435	T279S	probably damaging	Het
Olfr140	T	A	2: 90,051,913	H137L	probably benign	Het
Pabpc4	T	G	4: 123,290,307	D204E	probably benign	Het
Pigr	A	T	1: 130,849,493	M679L	probably benign	Het
Pik3c2b	A	T	1: 133,070,408	M341L	possibly damaging	Het
Plin4	T	A	17: 56,106,132	T498S	probably benign	Het
Ppp2r5e	A	G	12: 75,515,685	S15P	possibly damaging	Het
Prdm13	T	C	4: 21,678,984	Y502C	probably damaging	Het
Ptprk	T	C	10: 28,592,054		probably null	Het
Rapgef6	T	C	11: 54,657,374	S505P	probably benign	Het
Rgmb	G	T	17: 15,820,728	S199*	probably null	Het
Rgsl1	T	C	1: 153,827,492	T173A	probably damaging	Het
Rhobtb1	G	T	10: 69,269,912	K102N	probably damaging	Het
Ripor2	A	T	13: 24,674,666	D147V	probably damaging	Het
Rsad2	A	T	12: 26,450,682	V202E	probably damaging	Het
Slc1a6	A	G	10: 78,793,307	N186S	probably damaging	Het
Soga1	G	A	2: 157,023,817	Q1127*	probably null	Het
Sorbs3	G	A	14: 70,184,896	R622*	probably null	Het
Spag9	C	A	11: 94,069,012	D342E	probably damaging	Het
Srgap3	T	C	6: 112,766,939	Y446C	probably damaging	Het
Thsd7b	C	T	1: 129,678,243	R574*	probably null	Het
Tmem74	A	T	15: 43,866,821	Y275*	probably null	Het
Topors	A	T	4: 40,262,541	S248T	possibly damaging	Het
Trpm1	A	T	7: 64,208,946	Y239F	probably benign	Het
Ttn	T	A	2: 76,718,183	Y30179F	possibly damaging	Het
Ugt2b34	A	T	5: 86,892,865	F399L	probably damaging	Het
Ush2a	A	T	1: 188,356,798	I317F	probably damaging	Het
Usp1	T	C	4: 98,934,618	V723A	probably benign	Het
Usp34	T	G	11: 23,343,616	L237V	probably damaging	Het
Vgf	A	T	5: 137,032,286	D434V	probably damaging	Het
Vmn1r179	A	G	7: 23,928,675	N97S	probably benign	Het
Vps13a	A	G	19: 16,710,387	L899P	possibly damaging	Het
Vps33b	A	T	7: 80,274,253	I41F	probably damaging	Het
Zap70	A	T	1: 36,778,218	H210L	probably damaging	Het
Zc3h8	T	C	2: 128,928,915	D300G	probably benign	Het
Zfp958	C	A	8: 4,626,196	H55N	possibly damaging	Het

Other mutations in Chd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00704:Chd1	APN	17	15732565	missense	probably benign	0.37
IGL01356:Chd1	APN	17	15749865	missense	probably damaging	1.00
IGL01369:Chd1	APN	17	15754997	missense	probably damaging	0.97
IGL01519:Chd1	APN	17	17378569	missense	probably damaging	1.00
IGL01604:Chd1	APN	17	15770097	missense	possibly damaging	0.95
IGL01635:Chd1	APN	17	17378596	missense	probably damaging	1.00
IGL01721:Chd1	APN	17	15770168	missense	probably damaging	1.00
IGL01959:Chd1	APN	17	15742173	missense	probably damaging	1.00
IGL02367:Chd1	APN	17	17390053	missense	probably damaging	0.98
IGL02476:Chd1	APN	17	15734273	missense	probably damaging	1.00
IGL02756:Chd1	APN	17	15730807	missense	probably damaging	0.97
IGL02817:Chd1	APN	17	15749500	missense	possibly damaging	0.92
IGL03084:Chd1	APN	17	15770298	missense	probably benign	0.22
IGL03108:Chd1	APN	17	15725281	missense	possibly damaging	0.70
Holly	UTSW	17	15726283	missense	possibly damaging	0.72
R0053:Chd1	UTSW	17	15747189	missense	probably damaging	1.00
R0053:Chd1	UTSW	17	15747189	missense	probably damaging	1.00
R0128:Chd1	UTSW	17	17393567	missense	probably damaging	1.00
R0197:Chd1	UTSW	17	15725431	missense	probably benign
R0285:Chd1	UTSW	17	17374680	splice site	probably benign
R0326:Chd1	UTSW	17	15768566	missense	probably damaging	1.00
R0326:Chd1	UTSW	17	15768568	missense	probably benign
R0372:Chd1	UTSW	17	17387290	missense	probably benign	0.14
R0391:Chd1	UTSW	17	15749894	missense	probably damaging	1.00
R0486:Chd1	UTSW	17	15734342	missense	probably damaging	0.99
R0637:Chd1	UTSW	17	15742288	missense	possibly damaging	0.50
R0675:Chd1	UTSW	17	15758261	unclassified	probably benign
R0701:Chd1	UTSW	17	15725431	missense	probably benign
R0788:Chd1	UTSW	17	15707114	missense	possibly damaging	0.86
R0848:Chd1	UTSW	17	15770241	missense	probably damaging	1.00
R0883:Chd1	UTSW	17	15725431	missense	probably benign
R1169:Chd1	UTSW	17	15735732	missense	probably damaging	1.00
R1218:Chd1	UTSW	17	15725312	missense	probably damaging	1.00
R1370:Chd1	UTSW	17	17387480	missense	probably benign	0.00
R1470:Chd1	UTSW	17	15726283	missense	possibly damaging	0.72
R1470:Chd1	UTSW	17	15726283	missense	possibly damaging	0.72
R1478:Chd1	UTSW	17	15739507	missense	probably damaging	0.99
R1752:Chd1	UTSW	17	15743232	critical splice donor site	probably null
R1759:Chd1	UTSW	17	17387271	missense	probably benign	0.00
R1767:Chd1	UTSW	17	15770303	missense	probably damaging	1.00
R1938:Chd1	UTSW	17	15762486	missense	probably benign	0.39
R2007:Chd1	UTSW	17	15731006	missense	probably damaging	1.00
R2069:Chd1	UTSW	17	15742294	missense	probably damaging	1.00
R3771:Chd1	UTSW	17	17374651	missense	probably damaging	1.00
R3773:Chd1	UTSW	17	17374651	missense	probably damaging	1.00
R3849:Chd1	UTSW	17	15731871	missense	probably damaging	1.00
R4241:Chd1	UTSW	17	15770027	nonsense	probably null
R4242:Chd1	UTSW	17	15770027	nonsense	probably null
R4354:Chd1	UTSW	17	17390001	missense	probably benign	0.23
R4468:Chd1	UTSW	17	15760395	missense	probably damaging	0.99
R4469:Chd1	UTSW	17	15760395	missense	probably damaging	0.99
R4731:Chd1	UTSW	17	17377817	missense	probably benign	0.36
R4824:Chd1	UTSW	17	15733124	missense	probably damaging	1.00
R4840:Chd1	UTSW	17	15768753	nonsense	probably null
R4840:Chd1	UTSW	17	15768754	missense	probably damaging	1.00
R4880:Chd1	UTSW	17	17374654	missense	probably damaging	1.00
R4960:Chd1	UTSW	17	15742231	missense	probably damaging	0.96
R5071:Chd1	UTSW	17	15762405	missense	probably benign
R5078:Chd1	UTSW	17	15726354	missense	possibly damaging	0.93
R5114:Chd1	UTSW	17	15728198	missense	probably benign	0.25
R5268:Chd1	UTSW	17	15735743	missense	probably damaging	1.00
R5304:Chd1	UTSW	17	15770268	missense	possibly damaging	0.55
R5307:Chd1	UTSW	17	15732570	missense	probably damaging	1.00
R5458:Chd1	UTSW	17	15738549	missense	probably damaging	1.00
R5553:Chd1	UTSW	17	17385613	missense	probably benign	0.17
R5623:Chd1	UTSW	17	15754932	missense	probably damaging	1.00
R6022:Chd1	UTSW	17	17377773	missense	probably benign	0.39
R6137:Chd1	UTSW	17	15758688	missense	probably damaging	1.00
R6257:Chd1	UTSW	17	15730203	splice site	probably null
R6373:Chd1	UTSW	17	15738636	missense	probably damaging	1.00
R6458:Chd1	UTSW	17	15730602	missense	probably benign	0.01
R6476:Chd1	UTSW	17	17380988	critical splice donor site	probably null
R6508:Chd1	UTSW	17	15738633	missense	probably benign	0.31
R6553:Chd1	UTSW	17	15725430	missense	probably benign	0.00
R6745:Chd1	UTSW	17	17387167	missense	probably benign	0.08
R7107:Chd1	UTSW	17	15761366	missense	probably damaging	0.98
R7230:Chd1	UTSW	17	15706937	splice site	probably null
R7317:Chd1	UTSW	17	15742274	missense	possibly damaging	0.71
R7341:Chd1	UTSW	17	15770237	missense	probably damaging	0.99
R7421:Chd1	UTSW	17	15749398	missense	probably benign	0.03
R7704:Chd1	UTSW	17	15767475	missense	probably benign
R7763:Chd1	UTSW	17	15733041	missense	probably damaging	1.00
R8156:Chd1	UTSW	17	15761404	missense	probably benign
R8194:Chd1	UTSW	17	17374475	start gained	probably benign
R8261:Chd1	UTSW	17	17387542	missense	probably benign	0.02
R8338:Chd1	UTSW	17	15769980	missense	probably damaging	1.00
R8401:Chd1	UTSW	17	15743211	missense	probably damaging	1.00
R8411:Chd1	UTSW	17	15762449	missense	probably damaging	0.98
R9067:Chd1	UTSW	17	15730845	missense	possibly damaging	0.49
R9184:Chd1	UTSW	17	15742289	missense	possibly damaging	0.71
R9210:Chd1	UTSW	17	15730505	missense	possibly damaging	0.70
R9212:Chd1	UTSW	17	15730505	missense	possibly damaging	0.70
R9666:Chd1	UTSW	17	15735714	missense	probably damaging	1.00
R9673:Chd1	UTSW	17	15768761	missense	probably benign	0.24
Z1176:Chd1	UTSW	17	15766347	missense	probably damaging	0.98
Z1176:Chd1	UTSW	17	15768733	missense	probably damaging	1.00
Z1177:Chd1	UTSW	17	15747801	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTAGGTTGCCAGTTAGTAGC -3'
(R):5'- CCCAATCTAGTTTTCACAGTTAGTC -3'

Sequencing Primer
(F):5'- TGGAACTCCCTTTGTAGACCAGG -3'
(R):5'- AGTTTTCACAGTTAGTCTCATGTTC -3'

Posted On

2016-07-22