Incidental Mutation 'R5305:Rims1'
ID404473
Institutional Source Beutler Lab
Gene Symbol Rims1
Ensembl Gene ENSMUSG00000041670
Gene Nameregulating synaptic membrane exocytosis 1
SynonymsRIM1a, RIM1, RIM1alpha, C030033M19Rik
MMRRC Submission 042888-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.611) question?
Stock #R5305 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location22286251-22805994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 22596542 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 119 (R119S)
Ref Sequence ENSEMBL: ENSMUSP00000095417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081544] [ENSMUST00000097808] [ENSMUST00000097809] [ENSMUST00000097810] [ENSMUST00000097811] [ENSMUST00000115273] [ENSMUST00000218140]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081544
AA Change: R119S

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000080259
Gene: ENSMUSG00000041670
AA Change: R119S

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
Pfam:FYVE_2 102 205 2.6e-9 PFAM
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 899 934 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
C2 1120 1223 7.45e-15 SMART
low complexity region 1245 1253 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097808
AA Change: R119S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095417
Gene: ENSMUSG00000041670
AA Change: R119S

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
Pfam:FYVE_2 102 205 3.3e-10 PFAM
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097809
AA Change: R119S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000095418
Gene: ENSMUSG00000041670
AA Change: R119S

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
Pfam:FYVE_2 102 205 1e-9 PFAM
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 862 874 N/A INTRINSIC
low complexity region 974 1009 N/A INTRINSIC
low complexity region 1086 1100 N/A INTRINSIC
C2 1195 1298 7.45e-15 SMART
low complexity region 1320 1328 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097810
AA Change: R119S

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000095419
Gene: ENSMUSG00000041670
AA Change: R119S

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
PDB:2CJS|C 131 193 2e-32 PDB
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 862 874 N/A INTRINSIC
low complexity region 916 929 N/A INTRINSIC
low complexity region 1035 1070 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
C2 1256 1359 7.45e-15 SMART
low complexity region 1381 1389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097811
AA Change: R119S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000095420
Gene: ENSMUSG00000041670
AA Change: R119S

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
Pfam:FYVE_2 102 205 1.6e-9 PFAM
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 867 881 N/A INTRINSIC
low complexity region 944 957 N/A INTRINSIC
low complexity region 1063 1098 N/A INTRINSIC
low complexity region 1175 1189 N/A INTRINSIC
C2 1284 1387 7.45e-15 SMART
low complexity region 1409 1417 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115273
AA Change: R119S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000110928
Gene: ENSMUSG00000041670
AA Change: R119S

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
Pfam:FYVE_2 102 205 2.8e-9 PFAM
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 950 985 N/A INTRINSIC
low complexity region 1062 1076 N/A INTRINSIC
C2 1171 1274 7.45e-15 SMART
low complexity region 1296 1304 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000218140
AA Change: R119S

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.0947 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a RAS gene superfamily member that regulates synaptic vesicle exocytosis. This gene also plays a role in the regulation of voltage-gated calcium channels during neurotransmitter and insulin release. Mutations have suggested a role cognition and have been identified as the cause of cone-rod dystrophy type 7. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene display defects in maternal care and abnormalities in synaptic transmission in the central nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G A 15: 82,059,219 V11M possibly damaging Het
Acot8 A G 2: 164,795,765 V179A probably benign Het
Actb A G 5: 142,904,230 I194T probably benign Het
Ap1g2 A G 14: 55,099,076 V787A probably benign Het
Areg G T 5: 91,144,449 A203S probably damaging Het
Asb13 A T 13: 3,643,479 D79V probably damaging Het
Atad2b C T 12: 4,965,855 T527I probably damaging Het
Auts2 T G 5: 131,443,794 probably benign Het
Ceacam3 T A 7: 17,151,576 S35T probably damaging Het
Crebzf T C 7: 90,444,134 probably benign Het
Cttnbp2 G T 6: 18,381,098 N1366K probably benign Het
Cubn C A 2: 13,388,939 C1417F probably damaging Het
Dot1l C T 10: 80,790,793 P162S probably benign Het
Epc1 G A 18: 6,490,690 probably benign Het
Eps8l1 A G 7: 4,477,896 S613G possibly damaging Het
Erich6 T G 3: 58,625,116 I357L probably benign Het
Foxj3 T A 4: 119,619,958 S288T possibly damaging Het
Gls2 T G 10: 128,204,709 Y326* probably null Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm7535 T C 17: 17,911,799 probably benign Het
Gxylt2 T G 6: 100,787,218 L288R probably damaging Het
Kdm4a T C 4: 118,160,501 Y456C probably damaging Het
Mgat4c T A 10: 102,389,279 F451L possibly damaging Het
Mrpl20 G A 4: 155,803,705 R17H probably damaging Het
Mtf2 A G 5: 108,104,499 T465A possibly damaging Het
Mycbp2 A C 14: 103,346,321 L66R probably benign Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Nr2e1 A T 10: 42,571,487 Y176* probably null Het
Obscn T C 11: 59,012,715 T7628A possibly damaging Het
Olfr1353 A T 10: 78,970,556 K302N possibly damaging Het
Pitx2 T G 3: 129,215,840 V129G probably damaging Het
Polr2e A G 10: 80,038,063 probably benign Het
Ppard A G 17: 28,298,858 D300G probably damaging Het
Ppp1r27 A G 11: 120,550,917 V46A probably benign Het
Prex2 T A 1: 11,107,678 V332E probably damaging Het
Prss30 T G 17: 23,972,776 Y257S probably benign Het
Ptprd T C 4: 75,982,626 E1082G probably damaging Het
Rab3c T A 13: 110,181,077 R89S probably damaging Het
Rimbp2 A G 5: 128,797,381 V389A possibly damaging Het
Sema3b T C 9: 107,603,337 H137R probably null Het
Sf3b4 G C 3: 96,173,642 A89P probably damaging Het
Sgta T A 10: 81,046,247 Q298L probably damaging Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Sry T A Y: 2,662,982 D226V unknown Het
Sv2a A G 3: 96,185,458 E158G possibly damaging Het
Sytl2 A G 7: 90,381,863 probably benign Het
Thbs3 T A 3: 89,217,976 probably benign Het
Top3a A T 11: 60,762,539 N56K possibly damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Tyk2 T C 9: 21,109,381 D918G probably damaging Het
Uqcrh A G 4: 116,067,284 probably benign Het
Vmn1r61 A G 7: 5,610,815 S167P probably damaging Het
Wdr25 C A 12: 109,026,440 H74N probably damaging Het
Zfp458 T C 13: 67,256,318 N686D probably benign Het
Zfp574 T A 7: 25,081,090 H512Q probably damaging Het
Zfp976 A T 7: 42,613,478 Y312N probably benign Het
Zscan4c G A 7: 11,009,535 V354I probably benign Het
Other mutations in Rims1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Rims1 APN 1 22468242 missense probably damaging 1.00
IGL00535:Rims1 APN 1 22432921 missense probably benign 0.02
IGL01021:Rims1 APN 1 22486620 missense probably damaging 1.00
IGL01106:Rims1 APN 1 22379447 missense probably damaging 1.00
IGL01128:Rims1 APN 1 22534175 missense probably damaging 0.97
IGL01548:Rims1 APN 1 22538602 missense probably damaging 1.00
IGL01688:Rims1 APN 1 22397540 missense probably benign 0.22
IGL02089:Rims1 APN 1 22630475 missense possibly damaging 0.68
IGL02245:Rims1 APN 1 22346488 missense probably damaging 0.98
IGL02355:Rims1 APN 1 22483207 missense probably damaging 1.00
IGL02362:Rims1 APN 1 22483207 missense probably damaging 1.00
IGL02682:Rims1 APN 1 22288484 missense probably damaging 1.00
IGL03006:Rims1 APN 1 22296954 missense probably damaging 0.99
IGL03054:Rims1 UTSW 1 22290109 missense probably damaging 1.00
PIT4504001:Rims1 UTSW 1 22397460 missense
R0031:Rims1 UTSW 1 22296879 missense probably damaging 1.00
R0118:Rims1 UTSW 1 22346407 missense probably damaging 1.00
R0390:Rims1 UTSW 1 22596526 missense possibly damaging 0.92
R0483:Rims1 UTSW 1 22468182 splice site probably benign
R0744:Rims1 UTSW 1 22427459 splice site probably null
R0836:Rims1 UTSW 1 22427459 splice site probably null
R1218:Rims1 UTSW 1 22483175 missense probably damaging 1.00
R1228:Rims1 UTSW 1 22472756 missense probably null 1.00
R1374:Rims1 UTSW 1 22296948 missense probably damaging 1.00
R1474:Rims1 UTSW 1 22538281 splice site probably benign
R1652:Rims1 UTSW 1 22292866 missense probably damaging 1.00
R1712:Rims1 UTSW 1 22296948 missense probably damaging 1.00
R1730:Rims1 UTSW 1 22346529 critical splice acceptor site probably null
R1783:Rims1 UTSW 1 22346529 critical splice acceptor site probably null
R1861:Rims1 UTSW 1 22596558 missense probably damaging 1.00
R1899:Rims1 UTSW 1 22428474 missense probably damaging 1.00
R1937:Rims1 UTSW 1 22288530 missense probably damaging 1.00
R2010:Rims1 UTSW 1 22296996 missense probably damaging 1.00
R2049:Rims1 UTSW 1 22596435 missense probably damaging 1.00
R2124:Rims1 UTSW 1 22404508 nonsense probably null
R2860:Rims1 UTSW 1 22432976 missense probably benign 0.01
R2861:Rims1 UTSW 1 22432976 missense probably benign 0.01
R2914:Rims1 UTSW 1 22805630 missense probably damaging 1.00
R3740:Rims1 UTSW 1 22373443 missense probably damaging 1.00
R3741:Rims1 UTSW 1 22373443 missense probably damaging 1.00
R3773:Rims1 UTSW 1 22421810 missense probably damaging 1.00
R3874:Rims1 UTSW 1 22428489 missense probably damaging 1.00
R3901:Rims1 UTSW 1 22533497 missense probably benign 0.00
R3964:Rims1 UTSW 1 22427459 splice site probably null
R4037:Rims1 UTSW 1 22475712 missense probably damaging 0.96
R4039:Rims1 UTSW 1 22475712 missense probably damaging 0.96
R4056:Rims1 UTSW 1 22292939 splice site probably benign
R4062:Rims1 UTSW 1 22533583 missense probably benign 0.00
R4552:Rims1 UTSW 1 22373494 missense probably damaging 0.99
R4658:Rims1 UTSW 1 22427543 missense probably damaging 0.98
R4688:Rims1 UTSW 1 22479447 nonsense probably null
R4696:Rims1 UTSW 1 22288612 missense probably damaging 1.00
R4720:Rims1 UTSW 1 22427481 missense probably damaging 1.00
R4764:Rims1 UTSW 1 22479462 missense probably damaging 1.00
R4780:Rims1 UTSW 1 22291105 missense probably damaging 1.00
R4931:Rims1 UTSW 1 22533947 missense probably benign 0.26
R5137:Rims1 UTSW 1 22288620 nonsense probably null
R5153:Rims1 UTSW 1 22483247 nonsense probably null
R5354:Rims1 UTSW 1 22538511 missense probably damaging 1.00
R5386:Rims1 UTSW 1 22412245 missense probably damaging 0.99
R5485:Rims1 UTSW 1 22483208 missense possibly damaging 0.93
R5643:Rims1 UTSW 1 22538509 missense probably damaging 1.00
R5929:Rims1 UTSW 1 22468241 missense probably damaging 1.00
R5988:Rims1 UTSW 1 22596463 missense probably damaging 1.00
R6160:Rims1 UTSW 1 22432984 missense probably damaging 0.98
R6579:Rims1 UTSW 1 22425916 missense probably damaging 1.00
R6790:Rims1 UTSW 1 22468197 missense probably damaging 1.00
R7048:Rims1 UTSW 1 22472820 missense probably damaging 1.00
R7100:Rims1 UTSW 1 22346473 missense probably benign 0.27
R7155:Rims1 UTSW 1 22432923 missense probably damaging 0.99
R7171:Rims1 UTSW 1 22428489 missense
R7448:Rims1 UTSW 1 22404475 missense
R7505:Rims1 UTSW 1 22533996 missense possibly damaging 0.55
R7567:Rims1 UTSW 1 22468210 missense probably damaging 0.99
R7639:Rims1 UTSW 1 22805669 missense probably benign 0.02
R8005:Rims1 UTSW 1 22412213 missense
Z1088:Rims1 UTSW 1 22288586 missense probably damaging 1.00
Z1176:Rims1 UTSW 1 22484671 nonsense probably null
Z1177:Rims1 UTSW 1 22296939 missense possibly damaging 0.93
Z1177:Rims1 UTSW 1 22468241 missense probably damaging 1.00
Z1177:Rims1 UTSW 1 22472777 missense probably benign 0.44
Z1177:Rims1 UTSW 1 22472804 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCGATCGCAGAGACACTCG -3'
(R):5'- TCTTGACTGAGACCAGAAAGATCAG -3'

Sequencing Primer
(F):5'- AGAGACACTCGGCCTCC -3'
(R):5'- GACAGATTGCTTATGTTTTCAGCTTC -3'
Posted On2016-07-22