Incidental Mutation 'R5305:Acot8'
ID404478
Institutional Source Beutler Lab
Gene Symbol Acot8
Ensembl Gene ENSMUSG00000017307
Gene Nameacyl-CoA thioesterase 8
SynonymsPte1, PTE-2
MMRRC Submission 042888-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R5305 (G1)
Quality Score222
Status Validated
Chromosome2
Chromosomal Location164792765-164804882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 164795765 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 179 (V179A)
Ref Sequence ENSEMBL: ENSMUSP00000099383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017451] [ENSMUST00000056181] [ENSMUST00000103094] [ENSMUST00000134611] [ENSMUST00000172577] [ENSMUST00000174070]
Predicted Effect probably benign
Transcript: ENSMUST00000017451
AA Change: V179A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000017451
Gene: ENSMUSG00000017307
AA Change: V179A

DomainStartEndE-ValueType
Pfam:Acyl_CoA_thio 38 132 4.6e-9 PFAM
Pfam:4HBT_3 45 255 8.8e-30 PFAM
Pfam:Acyl_CoA_thio 180 253 2.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056181
SMART Domains Protein: ENSMUSP00000054137
Gene: ENSMUSG00000050373

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 17 28 N/A INTRINSIC
low complexity region 58 69 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
PX 124 232 4.19e-10 SMART
low complexity region 249 263 N/A INTRINSIC
low complexity region 334 343 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103094
AA Change: V179A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000099383
Gene: ENSMUSG00000017307
AA Change: V179A

DomainStartEndE-ValueType
Pfam:Acyl_CoA_thio 39 132 5e-9 PFAM
Pfam:4HBT_3 45 309 2.7e-44 PFAM
Pfam:Acyl_CoA_thio 180 308 5.3e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133053
Predicted Effect probably benign
Transcript: ENSMUST00000134611
SMART Domains Protein: ENSMUSP00000133718
Gene: ENSMUSG00000017307

DomainStartEndE-ValueType
low complexity region 79 113 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136767
Predicted Effect probably benign
Transcript: ENSMUST00000140519
Predicted Effect probably benign
Transcript: ENSMUST00000172577
SMART Domains Protein: ENSMUSP00000134133
Gene: ENSMUSG00000050373

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 17 28 N/A INTRINSIC
low complexity region 58 69 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173945
Predicted Effect probably benign
Transcript: ENSMUST00000174070
SMART Domains Protein: ENSMUSP00000133344
Gene: ENSMUSG00000050373

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 17 28 N/A INTRINSIC
low complexity region 58 69 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174342
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a peroxisomal thioesterase that appears to be involved more in the oxidation of fatty acids rather than in their formation. The encoded protein can bind to the human immunodeficiency virus-1 protein Nef, and mediate Nef-induced down-regulation of CD4 in T-cells. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G A 15: 82,059,219 V11M possibly damaging Het
Actb A G 5: 142,904,230 I194T probably benign Het
Ap1g2 A G 14: 55,099,076 V787A probably benign Het
Areg G T 5: 91,144,449 A203S probably damaging Het
Asb13 A T 13: 3,643,479 D79V probably damaging Het
Atad2b C T 12: 4,965,855 T527I probably damaging Het
Auts2 T G 5: 131,443,794 probably benign Het
Ceacam3 T A 7: 17,151,576 S35T probably damaging Het
Crebzf T C 7: 90,444,134 probably benign Het
Cttnbp2 G T 6: 18,381,098 N1366K probably benign Het
Cubn C A 2: 13,388,939 C1417F probably damaging Het
Dot1l C T 10: 80,790,793 P162S probably benign Het
Epc1 G A 18: 6,490,690 probably benign Het
Eps8l1 A G 7: 4,477,896 S613G possibly damaging Het
Erich6 T G 3: 58,625,116 I357L probably benign Het
Foxj3 T A 4: 119,619,958 S288T possibly damaging Het
Gls2 T G 10: 128,204,709 Y326* probably null Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm7535 T C 17: 17,911,799 probably benign Het
Gxylt2 T G 6: 100,787,218 L288R probably damaging Het
Kdm4a T C 4: 118,160,501 Y456C probably damaging Het
Mgat4c T A 10: 102,389,279 F451L possibly damaging Het
Mrpl20 G A 4: 155,803,705 R17H probably damaging Het
Mtf2 A G 5: 108,104,499 T465A possibly damaging Het
Mycbp2 A C 14: 103,346,321 L66R probably benign Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Nr2e1 A T 10: 42,571,487 Y176* probably null Het
Obscn T C 11: 59,012,715 T7628A possibly damaging Het
Olfr1353 A T 10: 78,970,556 K302N possibly damaging Het
Pitx2 T G 3: 129,215,840 V129G probably damaging Het
Polr2e A G 10: 80,038,063 probably benign Het
Ppard A G 17: 28,298,858 D300G probably damaging Het
Ppp1r27 A G 11: 120,550,917 V46A probably benign Het
Prex2 T A 1: 11,107,678 V332E probably damaging Het
Prss30 T G 17: 23,972,776 Y257S probably benign Het
Ptprd T C 4: 75,982,626 E1082G probably damaging Het
Rab3c T A 13: 110,181,077 R89S probably damaging Het
Rimbp2 A G 5: 128,797,381 V389A possibly damaging Het
Rims1 T A 1: 22,596,542 R119S probably damaging Het
Sema3b T C 9: 107,603,337 H137R probably null Het
Sf3b4 G C 3: 96,173,642 A89P probably damaging Het
Sgta T A 10: 81,046,247 Q298L probably damaging Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Sry T A Y: 2,662,982 D226V unknown Het
Sv2a A G 3: 96,185,458 E158G possibly damaging Het
Sytl2 A G 7: 90,381,863 probably benign Het
Thbs3 T A 3: 89,217,976 probably benign Het
Top3a A T 11: 60,762,539 N56K possibly damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Tyk2 T C 9: 21,109,381 D918G probably damaging Het
Uqcrh A G 4: 116,067,284 probably benign Het
Vmn1r61 A G 7: 5,610,815 S167P probably damaging Het
Wdr25 C A 12: 109,026,440 H74N probably damaging Het
Zfp458 T C 13: 67,256,318 N686D probably benign Het
Zfp574 T A 7: 25,081,090 H512Q probably damaging Het
Zfp976 A T 7: 42,613,478 Y312N probably benign Het
Zscan4c G A 7: 11,009,535 V354I probably benign Het
Other mutations in Acot8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Acot8 APN 2 164804815 start codon destroyed probably null 0.95
Etherial UTSW 2 164804735 missense possibly damaging 0.93
Evaporated UTSW 2 164795059 missense probably damaging 1.00
R1655:Acot8 UTSW 2 164803108 missense probably benign 0.00
R1980:Acot8 UTSW 2 164795044 missense probably damaging 1.00
R5049:Acot8 UTSW 2 164799690 intron probably benign
R6145:Acot8 UTSW 2 164803065 missense probably benign 0.44
R6261:Acot8 UTSW 2 164795059 missense probably damaging 1.00
R6458:Acot8 UTSW 2 164804735 missense possibly damaging 0.93
Z1088:Acot8 UTSW 2 164799813 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TATAGCCAAGCCACAGAGGG -3'
(R):5'- ATCAGTGCCTAGGCCTTAGC -3'

Sequencing Primer
(F):5'- CCAAGCCACAGAGGGCAATG -3'
(R):5'- TCGGCTCAGAGAGATGACTAACTTC -3'
Posted On2016-07-22