Incidental Mutation 'R5305:Thbs3'
ID404481
Institutional Source Beutler Lab
Gene Symbol Thbs3
Ensembl Gene ENSMUSG00000028047
Gene Namethrombospondin 3
SynonymsThbs-3, TSP3
MMRRC Submission 042888-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.482) question?
Stock #R5305 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location89215180-89226837 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 89217976 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029682] [ENSMUST00000073572] [ENSMUST00000118964] [ENSMUST00000119084] [ENSMUST00000142051] [ENSMUST00000152789] [ENSMUST00000174126]
Predicted Effect probably benign
Transcript: ENSMUST00000029682
SMART Domains Protein: ENSMUSP00000029682
Gene: ENSMUSG00000028047

DomainStartEndE-ValueType
TSPN 21 193 4.71e-56 SMART
Pfam:COMP 226 270 2.5e-22 PFAM
EGF 277 315 8.19e-2 SMART
EGF_CA 316 369 6.91e-9 SMART
EGF_CA 370 413 1.38e-8 SMART
EGF 417 456 1.99e0 SMART
Pfam:TSP_3 492 527 1e-12 PFAM
Pfam:TSP_3 551 586 2.2e-16 PFAM
Pfam:TSP_3 586 609 6.6e-7 PFAM
Pfam:TSP_3 610 647 2.6e-14 PFAM
Pfam:TSP_3 648 687 2.4e-10 PFAM
Pfam:TSP_3 688 723 4.2e-15 PFAM
Pfam:TSP_C 741 938 3.3e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073572
SMART Domains Protein: ENSMUSP00000073261
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
low complexity region 94 109 N/A INTRINSIC
Pfam:Tom37 151 219 4.2e-21 PFAM
Pfam:Tom37_C 239 317 8.1e-24 PFAM
Pfam:GST_C_3 267 383 1.7e-11 PFAM
Pfam:GST_C_2 270 377 2.7e-8 PFAM
Pfam:Tom37_C 300 369 1.1e-14 PFAM
low complexity region 396 415 N/A INTRINSIC
transmembrane domain 416 438 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118964
SMART Domains Protein: ENSMUSP00000114009
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
low complexity region 94 109 N/A INTRINSIC
Pfam:Tom37 151 219 5.9e-21 PFAM
Pfam:Tom37_C 216 287 6.3e-19 PFAM
Pfam:GST_C_3 216 352 5.1e-11 PFAM
Pfam:GST_C_2 238 344 1.9e-8 PFAM
Pfam:Tom37_C 269 338 9.5e-15 PFAM
low complexity region 365 384 N/A INTRINSIC
transmembrane domain 385 407 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119084
SMART Domains Protein: ENSMUSP00000112912
Gene: ENSMUSG00000028047

DomainStartEndE-ValueType
TSPN 21 193 4.71e-56 SMART
Pfam:COMP 226 270 8.2e-26 PFAM
EGF 277 315 8.19e-2 SMART
EGF_CA 316 369 6.91e-9 SMART
EGF_CA 370 413 1.38e-8 SMART
Pfam:TSP_3 455 490 4.4e-13 PFAM
Pfam:TSP_3 514 549 9.3e-17 PFAM
Pfam:TSP_3 549 572 2.8e-7 PFAM
Pfam:TSP_3 573 610 1.1e-14 PFAM
Pfam:TSP_3 611 650 1e-10 PFAM
Pfam:TSP_3 651 686 1.8e-15 PFAM
Pfam:TSP_C 704 904 7.9e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119222
SMART Domains Protein: ENSMUSP00000113986
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
Pfam:Tom37 12 57 1.6e-11 PFAM
Pfam:Tom37_C 138 216 5.4e-24 PFAM
Pfam:GST_C_3 166 282 1.1e-11 PFAM
Pfam:GST_C_2 169 276 1.8e-8 PFAM
Pfam:Tom37_C 199 268 7.2e-15 PFAM
low complexity region 295 314 N/A INTRINSIC
transmembrane domain 315 337 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126700
Predicted Effect probably benign
Transcript: ENSMUST00000142051
SMART Domains Protein: ENSMUSP00000116136
Gene: ENSMUSG00000028047

DomainStartEndE-ValueType
TSPN 1 124 2.52e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150303
Predicted Effect probably benign
Transcript: ENSMUST00000152789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156847
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173239
Predicted Effect probably benign
Transcript: ENSMUST00000173465
Predicted Effect probably benign
Transcript: ENSMUST00000173477
SMART Domains Protein: ENSMUSP00000133282
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
Pfam:Tom37 1 58 8.5e-16 PFAM
Pfam:Tom37_C 77 155 9.7e-24 PFAM
Pfam:GST_C_3 104 221 8.2e-12 PFAM
Pfam:GST_C_2 107 216 7.5e-9 PFAM
Pfam:Tom37_C 138 207 1.3e-14 PFAM
low complexity region 234 253 N/A INTRINSIC
transmembrane domain 254 276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173593
SMART Domains Protein: ENSMUSP00000133866
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
Pfam:Tom37 14 82 1.1e-21 PFAM
Pfam:Tom37_C 102 178 3.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174126
SMART Domains Protein: ENSMUSP00000133291
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
Pfam:Tom37_C 1 74 7.6e-23 PFAM
Pfam:GST_C_3 7 143 7.3e-12 PFAM
Pfam:GST_C_2 26 137 2.8e-9 PFAM
Pfam:Tom37_C 61 129 6.2e-15 PFAM
low complexity region 159 169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199915
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin family. Thrombospondin family members are adhesive glycoproteins that mediate cell-to-cell and cell-to-matrix interactions. This protein forms a pentameric molecule linked by a single disulfide bond. This gene shares a common promoter with metaxin 1. Alternate splicing results in coding and non-coding transcript variants. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous null mice at a young age are heavier and exhibit femurs with increased periosteal and endocortical diameters, greater moments of inertia and increased bending strength and failure loads, with these defects no longer detected in older mice. Femoral heads show accelerated bone ossification. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G A 15: 82,059,219 V11M possibly damaging Het
Acot8 A G 2: 164,795,765 V179A probably benign Het
Actb A G 5: 142,904,230 I194T probably benign Het
Ap1g2 A G 14: 55,099,076 V787A probably benign Het
Areg G T 5: 91,144,449 A203S probably damaging Het
Asb13 A T 13: 3,643,479 D79V probably damaging Het
Atad2b C T 12: 4,965,855 T527I probably damaging Het
Auts2 T G 5: 131,443,794 probably benign Het
Ceacam3 T A 7: 17,151,576 S35T probably damaging Het
Crebzf T C 7: 90,444,134 probably benign Het
Cttnbp2 G T 6: 18,381,098 N1366K probably benign Het
Cubn C A 2: 13,388,939 C1417F probably damaging Het
Dot1l C T 10: 80,790,793 P162S probably benign Het
Epc1 G A 18: 6,490,690 probably benign Het
Eps8l1 A G 7: 4,477,896 S613G possibly damaging Het
Erich6 T G 3: 58,625,116 I357L probably benign Het
Foxj3 T A 4: 119,619,958 S288T possibly damaging Het
Gls2 T G 10: 128,204,709 Y326* probably null Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm7535 T C 17: 17,911,799 probably benign Het
Gxylt2 T G 6: 100,787,218 L288R probably damaging Het
Kdm4a T C 4: 118,160,501 Y456C probably damaging Het
Mgat4c T A 10: 102,389,279 F451L possibly damaging Het
Mrpl20 G A 4: 155,803,705 R17H probably damaging Het
Mtf2 A G 5: 108,104,499 T465A possibly damaging Het
Mycbp2 A C 14: 103,346,321 L66R probably benign Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Nr2e1 A T 10: 42,571,487 Y176* probably null Het
Obscn T C 11: 59,012,715 T7628A possibly damaging Het
Olfr1353 A T 10: 78,970,556 K302N possibly damaging Het
Pitx2 T G 3: 129,215,840 V129G probably damaging Het
Polr2e A G 10: 80,038,063 probably benign Het
Ppard A G 17: 28,298,858 D300G probably damaging Het
Ppp1r27 A G 11: 120,550,917 V46A probably benign Het
Prex2 T A 1: 11,107,678 V332E probably damaging Het
Prss30 T G 17: 23,972,776 Y257S probably benign Het
Ptprd T C 4: 75,982,626 E1082G probably damaging Het
Rab3c T A 13: 110,181,077 R89S probably damaging Het
Rimbp2 A G 5: 128,797,381 V389A possibly damaging Het
Rims1 T A 1: 22,596,542 R119S probably damaging Het
Sema3b T C 9: 107,603,337 H137R probably null Het
Sf3b4 G C 3: 96,173,642 A89P probably damaging Het
Sgta T A 10: 81,046,247 Q298L probably damaging Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Sry T A Y: 2,662,982 D226V unknown Het
Sv2a A G 3: 96,185,458 E158G possibly damaging Het
Sytl2 A G 7: 90,381,863 probably benign Het
Top3a A T 11: 60,762,539 N56K possibly damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Tyk2 T C 9: 21,109,381 D918G probably damaging Het
Uqcrh A G 4: 116,067,284 probably benign Het
Vmn1r61 A G 7: 5,610,815 S167P probably damaging Het
Wdr25 C A 12: 109,026,440 H74N probably damaging Het
Zfp458 T C 13: 67,256,318 N686D probably benign Het
Zfp574 T A 7: 25,081,090 H512Q probably damaging Het
Zfp976 A T 7: 42,613,478 Y312N probably benign Het
Zscan4c G A 7: 11,009,535 V354I probably benign Het
Other mutations in Thbs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01838:Thbs3 APN 3 89219058 nonsense probably null
IGL02927:Thbs3 APN 3 89220207 missense probably damaging 0.98
IGL02980:Thbs3 UTSW 3 89223144 missense probably benign
R0648:Thbs3 UTSW 3 89216665 intron probably null
R0690:Thbs3 UTSW 3 89220165 missense possibly damaging 0.50
R1856:Thbs3 UTSW 3 89226406 missense probably damaging 1.00
R1928:Thbs3 UTSW 3 89217760 missense probably damaging 1.00
R2116:Thbs3 UTSW 3 89219392 missense probably damaging 1.00
R4600:Thbs3 UTSW 3 89224590 missense probably damaging 0.97
R4719:Thbs3 UTSW 3 89216840 missense probably damaging 1.00
R4947:Thbs3 UTSW 3 89226431 missense probably damaging 1.00
R4989:Thbs3 UTSW 3 89223102 intron probably benign
R5134:Thbs3 UTSW 3 89223102 intron probably benign
R5217:Thbs3 UTSW 3 89223164 critical splice donor site probably null
R5354:Thbs3 UTSW 3 89221377 missense probably damaging 1.00
R5444:Thbs3 UTSW 3 89223385 intron probably benign
R5569:Thbs3 UTSW 3 89219463 missense probably damaging 1.00
R5646:Thbs3 UTSW 3 89219098 missense probably damaging 1.00
R5801:Thbs3 UTSW 3 89224397 missense probably benign 0.15
R5886:Thbs3 UTSW 3 89220163 missense probably damaging 1.00
R6031:Thbs3 UTSW 3 89218094 missense probably damaging 0.99
R6031:Thbs3 UTSW 3 89218094 missense probably damaging 0.99
R6943:Thbs3 UTSW 3 89224864 missense probably benign 0.01
R7017:Thbs3 UTSW 3 89224415 missense probably damaging 1.00
R7352:Thbs3 UTSW 3 89225280 missense probably benign 0.03
R7570:Thbs3 UTSW 3 89219052 nonsense probably null
R7671:Thbs3 UTSW 3 89216707 missense probably benign 0.01
R7707:Thbs3 UTSW 3 89224900 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGTGAACCTACAGCAAGCAG -3'
(R):5'- AGAAGGATCTGTTACCTGCATTG -3'

Sequencing Primer
(F):5'- AAGCAGGCCTGGCTGATG -3'
(R):5'- ATCTGTTACCTGCATTGTGAATG -3'
Posted On2016-07-22