Incidental Mutation 'R5305:Sv2a'
ID404483
Institutional Source Beutler Lab
Gene Symbol Sv2a
Ensembl Gene ENSMUSG00000038486
Gene Namesynaptic vesicle glycoprotein 2 a
Synonyms
MMRRC Submission 042888-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5305 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location96181151-96195521 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96185458 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 158 (E158G)
Ref Sequence ENSEMBL: ENSMUSP00000037576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035371]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035371
AA Change: E158G

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037576
Gene: ENSMUSG00000038486
AA Change: E158G

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
low complexity region 39 58 N/A INTRINSIC
low complexity region 68 79 N/A INTRINSIC
low complexity region 123 138 N/A INTRINSIC
Pfam:Sugar_tr 149 484 5.3e-30 PFAM
Pfam:MFS_1 168 483 1.6e-24 PFAM
Pfam:Pentapeptide_4 513 585 7.7e-11 PFAM
Pfam:MFS_1 561 739 3.9e-12 PFAM
Pfam:Sugar_tr 588 742 4.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133665
Meta Mutation Damage Score 0.2562 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of three related synaptic vesicle proteins. The encoded protein may interact with synaptotagmin to enhance low frequency neurotransmission in quiescent neurons. [provided by RefSeq, Jun 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit seizures, retarded growth, and reduced hippocampal (GABA)ergic neurotransmission. Many mutants die shortly after birth, and all are dead by three weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G A 15: 82,059,219 V11M possibly damaging Het
Acot8 A G 2: 164,795,765 V179A probably benign Het
Actb A G 5: 142,904,230 I194T probably benign Het
Ap1g2 A G 14: 55,099,076 V787A probably benign Het
Areg G T 5: 91,144,449 A203S probably damaging Het
Asb13 A T 13: 3,643,479 D79V probably damaging Het
Atad2b C T 12: 4,965,855 T527I probably damaging Het
Auts2 T G 5: 131,443,794 probably benign Het
Ceacam3 T A 7: 17,151,576 S35T probably damaging Het
Crebzf T C 7: 90,444,134 probably benign Het
Cttnbp2 G T 6: 18,381,098 N1366K probably benign Het
Cubn C A 2: 13,388,939 C1417F probably damaging Het
Dot1l C T 10: 80,790,793 P162S probably benign Het
Epc1 G A 18: 6,490,690 probably benign Het
Eps8l1 A G 7: 4,477,896 S613G possibly damaging Het
Erich6 T G 3: 58,625,116 I357L probably benign Het
Foxj3 T A 4: 119,619,958 S288T possibly damaging Het
Gls2 T G 10: 128,204,709 Y326* probably null Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm7535 T C 17: 17,911,799 probably benign Het
Gxylt2 T G 6: 100,787,218 L288R probably damaging Het
Kdm4a T C 4: 118,160,501 Y456C probably damaging Het
Mgat4c T A 10: 102,389,279 F451L possibly damaging Het
Mrpl20 G A 4: 155,803,705 R17H probably damaging Het
Mtf2 A G 5: 108,104,499 T465A possibly damaging Het
Mycbp2 A C 14: 103,346,321 L66R probably benign Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Nr2e1 A T 10: 42,571,487 Y176* probably null Het
Obscn T C 11: 59,012,715 T7628A possibly damaging Het
Olfr1353 A T 10: 78,970,556 K302N possibly damaging Het
Pitx2 T G 3: 129,215,840 V129G probably damaging Het
Polr2e A G 10: 80,038,063 probably benign Het
Ppard A G 17: 28,298,858 D300G probably damaging Het
Ppp1r27 A G 11: 120,550,917 V46A probably benign Het
Prex2 T A 1: 11,107,678 V332E probably damaging Het
Prss30 T G 17: 23,972,776 Y257S probably benign Het
Ptprd T C 4: 75,982,626 E1082G probably damaging Het
Rab3c T A 13: 110,181,077 R89S probably damaging Het
Rimbp2 A G 5: 128,797,381 V389A possibly damaging Het
Rims1 T A 1: 22,596,542 R119S probably damaging Het
Sema3b T C 9: 107,603,337 H137R probably null Het
Sf3b4 G C 3: 96,173,642 A89P probably damaging Het
Sgta T A 10: 81,046,247 Q298L probably damaging Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Sry T A Y: 2,662,982 D226V unknown Het
Sytl2 A G 7: 90,381,863 probably benign Het
Thbs3 T A 3: 89,217,976 probably benign Het
Top3a A T 11: 60,762,539 N56K possibly damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Tyk2 T C 9: 21,109,381 D918G probably damaging Het
Uqcrh A G 4: 116,067,284 probably benign Het
Vmn1r61 A G 7: 5,610,815 S167P probably damaging Het
Wdr25 C A 12: 109,026,440 H74N probably damaging Het
Zfp458 T C 13: 67,256,318 N686D probably benign Het
Zfp574 T A 7: 25,081,090 H512Q probably damaging Het
Zfp976 A T 7: 42,613,478 Y312N probably benign Het
Zscan4c G A 7: 11,009,535 V354I probably benign Het
Other mutations in Sv2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Sv2a APN 3 96193284 missense probably benign 0.00
IGL01081:Sv2a APN 3 96189696 missense probably benign 0.35
IGL01786:Sv2a APN 3 96188209 missense probably benign 0.08
IGL02220:Sv2a APN 3 96190716 missense probably benign 0.13
IGL02701:Sv2a APN 3 96187131 missense probably damaging 0.99
IGL02740:Sv2a APN 3 96185407 missense possibly damaging 0.92
IGL03067:Sv2a APN 3 96185182 missense probably damaging 1.00
R0760:Sv2a UTSW 3 96188182 missense probably damaging 1.00
R2070:Sv2a UTSW 3 96193875 missense possibly damaging 0.95
R2071:Sv2a UTSW 3 96193875 missense possibly damaging 0.95
R2902:Sv2a UTSW 3 96193756 missense possibly damaging 0.84
R3014:Sv2a UTSW 3 96189435 nonsense probably null
R3153:Sv2a UTSW 3 96185258 missense possibly damaging 0.75
R4472:Sv2a UTSW 3 96192494 missense probably benign 0.36
R4653:Sv2a UTSW 3 96190762 critical splice donor site probably null
R4791:Sv2a UTSW 3 96192558 missense possibly damaging 0.68
R4844:Sv2a UTSW 3 96188379 missense probably damaging 1.00
R4919:Sv2a UTSW 3 96190755 missense probably benign 0.44
R5230:Sv2a UTSW 3 96185460 missense probably damaging 1.00
R5656:Sv2a UTSW 3 96185572 missense probably damaging 1.00
R5659:Sv2a UTSW 3 96190303 missense possibly damaging 0.96
R5722:Sv2a UTSW 3 96185023 missense probably benign 0.01
R6299:Sv2a UTSW 3 96188249 critical splice donor site probably null
R6315:Sv2a UTSW 3 96188186 missense probably benign 0.06
R7192:Sv2a UTSW 3 96193746 missense probably damaging 1.00
R7374:Sv2a UTSW 3 96188209 missense probably benign 0.08
R7691:Sv2a UTSW 3 96188411 missense probably benign 0.00
X0026:Sv2a UTSW 3 96189452 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGGAGAATATCAGGGCATCC -3'
(R):5'- GATACAGCTTGCAAAACTAGTGGG -3'

Sequencing Primer
(F):5'- ATCCCCCGGGCAGAGTC -3'
(R):5'- AACTAGTGGGACAGTCTGGCTC -3'
Posted On2016-07-22