Incidental Mutation 'R5305:Pitx2'
ID404484
Institutional Source Beutler Lab
Gene Symbol Pitx2
Ensembl Gene ENSMUSG00000028023
Gene Namepaired-like homeodomain transcription factor 2
SynonymsPitx2b, Pitx2a, Brx1, solurshin, Brx1a, Brx1b, Ptx2, Otlx2, Pitx2c, Rieg, Munc30
MMRRC Submission 042888-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5305 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location129199878-129219591 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 129215840 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 129 (V129G)
Ref Sequence ENSEMBL: ENSMUSP00000133756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029657] [ENSMUST00000042587] [ENSMUST00000106382] [ENSMUST00000172645] [ENSMUST00000174623] [ENSMUST00000174661]
Predicted Effect probably benign
Transcript: ENSMUST00000029657
Predicted Effect probably damaging
Transcript: ENSMUST00000042587
AA Change: V136G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047359
Gene: ENSMUSG00000028023
AA Change: V136G

DomainStartEndE-ValueType
HOX 92 154 6.5e-26 SMART
low complexity region 213 236 N/A INTRINSIC
low complexity region 244 262 N/A INTRINSIC
low complexity region 263 280 N/A INTRINSIC
Pfam:OAR 282 300 4.9e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106382
AA Change: V83G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101990
Gene: ENSMUSG00000028023
AA Change: V83G

DomainStartEndE-ValueType
HOX 39 101 6.5e-26 SMART
low complexity region 160 183 N/A INTRINSIC
low complexity region 191 209 N/A INTRINSIC
low complexity region 210 227 N/A INTRINSIC
Pfam:OAR 228 248 2.9e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172645
AA Change: V116G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134692
Gene: ENSMUSG00000028023
AA Change: V116G

DomainStartEndE-ValueType
HOX 72 134 6.5e-26 SMART
low complexity region 193 216 N/A INTRINSIC
low complexity region 224 242 N/A INTRINSIC
low complexity region 243 260 N/A INTRINSIC
Pfam:OAR 262 280 9.5e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174623
AA Change: V136G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139328
Gene: ENSMUSG00000028023
AA Change: V136G

DomainStartEndE-ValueType
HOX 92 151 1.37e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174661
AA Change: V129G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133756
Gene: ENSMUSG00000028023
AA Change: V129G

DomainStartEndE-ValueType
HOX 85 147 6.5e-26 SMART
low complexity region 206 229 N/A INTRINSIC
low complexity region 237 255 N/A INTRINSIC
low complexity region 256 273 N/A INTRINSIC
Pfam:OAR 274 294 1.8e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187145
Meta Mutation Damage Score 0.9353 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RIEG/PITX homeobox family, which is in the bicoid class of homeodomain proteins. The encoded protein acts as a transcription factor and regulates procollagen lysyl hydroxylase gene expression. This protein plays a role in the terminal differentiation of somatotroph and lactotroph cell phenotypes, is involved in the development of the eye, tooth and abdominal organs, and acts as a transcriptional regulator involved in basal and hormone-regulated activity of prolactin. Mutations in this gene are associated with Axenfeld-Rieger syndrome, iridogoniodysgenesis syndrome, and sporadic cases of Peters anomaly. A similar protein in other vertebrates is involved in the determination of left-right asymmetry during development. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations show failed ventral body wall closure, right pulmonary isomerism, septal and valve defects, absent ocular muscles, arrested pituitary and tooth development, optic nerve, mandible and maxilla defects, and embryonic death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G A 15: 82,059,219 V11M possibly damaging Het
Acot8 A G 2: 164,795,765 V179A probably benign Het
Actb A G 5: 142,904,230 I194T probably benign Het
Ap1g2 A G 14: 55,099,076 V787A probably benign Het
Areg G T 5: 91,144,449 A203S probably damaging Het
Asb13 A T 13: 3,643,479 D79V probably damaging Het
Atad2b C T 12: 4,965,855 T527I probably damaging Het
Auts2 T G 5: 131,443,794 probably benign Het
Ceacam3 T A 7: 17,151,576 S35T probably damaging Het
Crebzf T C 7: 90,444,134 probably benign Het
Cttnbp2 G T 6: 18,381,098 N1366K probably benign Het
Cubn C A 2: 13,388,939 C1417F probably damaging Het
Dot1l C T 10: 80,790,793 P162S probably benign Het
Epc1 G A 18: 6,490,690 probably benign Het
Eps8l1 A G 7: 4,477,896 S613G possibly damaging Het
Erich6 T G 3: 58,625,116 I357L probably benign Het
Foxj3 T A 4: 119,619,958 S288T possibly damaging Het
Gls2 T G 10: 128,204,709 Y326* probably null Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm7535 T C 17: 17,911,799 probably benign Het
Gxylt2 T G 6: 100,787,218 L288R probably damaging Het
Kdm4a T C 4: 118,160,501 Y456C probably damaging Het
Mgat4c T A 10: 102,389,279 F451L possibly damaging Het
Mrpl20 G A 4: 155,803,705 R17H probably damaging Het
Mtf2 A G 5: 108,104,499 T465A possibly damaging Het
Mycbp2 A C 14: 103,346,321 L66R probably benign Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Nr2e1 A T 10: 42,571,487 Y176* probably null Het
Obscn T C 11: 59,012,715 T7628A possibly damaging Het
Olfr1353 A T 10: 78,970,556 K302N possibly damaging Het
Polr2e A G 10: 80,038,063 probably benign Het
Ppard A G 17: 28,298,858 D300G probably damaging Het
Ppp1r27 A G 11: 120,550,917 V46A probably benign Het
Prex2 T A 1: 11,107,678 V332E probably damaging Het
Prss30 T G 17: 23,972,776 Y257S probably benign Het
Ptprd T C 4: 75,982,626 E1082G probably damaging Het
Rab3c T A 13: 110,181,077 R89S probably damaging Het
Rimbp2 A G 5: 128,797,381 V389A possibly damaging Het
Rims1 T A 1: 22,596,542 R119S probably damaging Het
Sema3b T C 9: 107,603,337 H137R probably null Het
Sf3b4 G C 3: 96,173,642 A89P probably damaging Het
Sgta T A 10: 81,046,247 Q298L probably damaging Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Sry T A Y: 2,662,982 D226V unknown Het
Sv2a A G 3: 96,185,458 E158G possibly damaging Het
Sytl2 A G 7: 90,381,863 probably benign Het
Thbs3 T A 3: 89,217,976 probably benign Het
Top3a A T 11: 60,762,539 N56K possibly damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Tyk2 T C 9: 21,109,381 D918G probably damaging Het
Uqcrh A G 4: 116,067,284 probably benign Het
Vmn1r61 A G 7: 5,610,815 S167P probably damaging Het
Wdr25 C A 12: 109,026,440 H74N probably damaging Het
Zfp458 T C 13: 67,256,318 N686D probably benign Het
Zfp574 T A 7: 25,081,090 H512Q probably damaging Het
Zfp976 A T 7: 42,613,478 Y312N probably benign Het
Zscan4c G A 7: 11,009,535 V354I probably benign Het
Other mutations in Pitx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Pitx2 APN 3 129214764 missense probably damaging 0.99
IGL02110:Pitx2 APN 3 129218817 missense probably damaging 0.99
R0014:Pitx2 UTSW 3 129218499 missense possibly damaging 0.70
R1083:Pitx2 UTSW 3 129218769 missense probably damaging 1.00
R1474:Pitx2 UTSW 3 129218839 missense probably damaging 1.00
R1789:Pitx2 UTSW 3 129218754 missense probably damaging 1.00
R1945:Pitx2 UTSW 3 129218536 missense probably damaging 1.00
R5950:Pitx2 UTSW 3 129218520 missense probably damaging 1.00
R6114:Pitx2 UTSW 3 129204413 intron probably null
R6189:Pitx2 UTSW 3 129218469 missense probably damaging 1.00
R6192:Pitx2 UTSW 3 129215872 missense probably benign 0.09
R6226:Pitx2 UTSW 3 129215842 missense probably damaging 1.00
R6526:Pitx2 UTSW 3 129214783 critical splice donor site probably null
R6778:Pitx2 UTSW 3 129218743 missense probably damaging 1.00
R6885:Pitx2 UTSW 3 129218608 missense probably damaging 1.00
R7575:Pitx2 UTSW 3 129215726 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAGTCTGACCCGAAACTATG -3'
(R):5'- CACAATGCCCTTTGCTGAGG -3'

Sequencing Primer
(F):5'- TGCTTTTTCAGAGAAAGATAAGGGCC -3'
(R):5'- AATGCCCTTTGCTGAGGAATGC -3'
Posted On2016-07-22