Incidental Mutation 'R5305:Foxj3'
ID404489
Institutional Source Beutler Lab
Gene Symbol Foxj3
Ensembl Gene ENSMUSG00000032998
Gene Nameforkhead box J3
SynonymsC330039G02Rik, Fhd6
MMRRC Submission 042888-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.420) question?
Stock #R5305 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location119537004-119629119 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119619958 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 288 (S288T)
Ref Sequence ENSEMBL: ENSMUSP00000101917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044564] [ENSMUST00000106310]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044564
AA Change: S322T

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000035746
Gene: ENSMUSG00000032998
AA Change: S322T

DomainStartEndE-ValueType
FH 76 164 6.03e-50 SMART
low complexity region 226 239 N/A INTRINSIC
low complexity region 263 274 N/A INTRINSIC
low complexity region 317 346 N/A INTRINSIC
low complexity region 372 434 N/A INTRINSIC
low complexity region 611 620 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106310
AA Change: S288T

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101917
Gene: ENSMUSG00000032998
AA Change: S288T

DomainStartEndE-ValueType
FH 76 164 6.03e-50 SMART
low complexity region 192 205 N/A INTRINSIC
low complexity region 229 240 N/A INTRINSIC
low complexity region 283 312 N/A INTRINSIC
low complexity region 338 400 N/A INTRINSIC
low complexity region 577 586 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133097
Meta Mutation Damage Score 0.0614 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (67/68)
MGI Phenotype PHENOTYPE: Homozygous null mice have an abnormal skeletal muscle fiber type ratio in males as well as defects in muscle regeneration following injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G A 15: 82,059,219 V11M possibly damaging Het
Acot8 A G 2: 164,795,765 V179A probably benign Het
Actb A G 5: 142,904,230 I194T probably benign Het
Ap1g2 A G 14: 55,099,076 V787A probably benign Het
Areg G T 5: 91,144,449 A203S probably damaging Het
Asb13 A T 13: 3,643,479 D79V probably damaging Het
Atad2b C T 12: 4,965,855 T527I probably damaging Het
Auts2 T G 5: 131,443,794 probably benign Het
Ceacam3 T A 7: 17,151,576 S35T probably damaging Het
Crebzf T C 7: 90,444,134 probably benign Het
Cttnbp2 G T 6: 18,381,098 N1366K probably benign Het
Cubn C A 2: 13,388,939 C1417F probably damaging Het
Dot1l C T 10: 80,790,793 P162S probably benign Het
Epc1 G A 18: 6,490,690 probably benign Het
Eps8l1 A G 7: 4,477,896 S613G possibly damaging Het
Erich6 T G 3: 58,625,116 I357L probably benign Het
Gls2 T G 10: 128,204,709 Y326* probably null Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm7535 T C 17: 17,911,799 probably benign Het
Gxylt2 T G 6: 100,787,218 L288R probably damaging Het
Kdm4a T C 4: 118,160,501 Y456C probably damaging Het
Mgat4c T A 10: 102,389,279 F451L possibly damaging Het
Mrpl20 G A 4: 155,803,705 R17H probably damaging Het
Mtf2 A G 5: 108,104,499 T465A possibly damaging Het
Mycbp2 A C 14: 103,346,321 L66R probably benign Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Nr2e1 A T 10: 42,571,487 Y176* probably null Het
Obscn T C 11: 59,012,715 T7628A possibly damaging Het
Olfr1353 A T 10: 78,970,556 K302N possibly damaging Het
Pitx2 T G 3: 129,215,840 V129G probably damaging Het
Polr2e A G 10: 80,038,063 probably benign Het
Ppard A G 17: 28,298,858 D300G probably damaging Het
Ppp1r27 A G 11: 120,550,917 V46A probably benign Het
Prex2 T A 1: 11,107,678 V332E probably damaging Het
Prss30 T G 17: 23,972,776 Y257S probably benign Het
Ptprd T C 4: 75,982,626 E1082G probably damaging Het
Rab3c T A 13: 110,181,077 R89S probably damaging Het
Rimbp2 A G 5: 128,797,381 V389A possibly damaging Het
Rims1 T A 1: 22,596,542 R119S probably damaging Het
Sema3b T C 9: 107,603,337 H137R probably null Het
Sf3b4 G C 3: 96,173,642 A89P probably damaging Het
Sgta T A 10: 81,046,247 Q298L probably damaging Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Sry T A Y: 2,662,982 D226V unknown Het
Sv2a A G 3: 96,185,458 E158G possibly damaging Het
Sytl2 A G 7: 90,381,863 probably benign Het
Thbs3 T A 3: 89,217,976 probably benign Het
Top3a A T 11: 60,762,539 N56K possibly damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Tyk2 T C 9: 21,109,381 D918G probably damaging Het
Uqcrh A G 4: 116,067,284 probably benign Het
Vmn1r61 A G 7: 5,610,815 S167P probably damaging Het
Wdr25 C A 12: 109,026,440 H74N probably damaging Het
Zfp458 T C 13: 67,256,318 N686D probably benign Het
Zfp574 T A 7: 25,081,090 H512Q probably damaging Het
Zfp976 A T 7: 42,613,478 Y312N probably benign Het
Zscan4c G A 7: 11,009,535 V354I probably benign Het
Other mutations in Foxj3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01072:Foxj3 APN 4 119610029 missense probably benign 0.03
IGL01452:Foxj3 APN 4 119621628 missense unknown
IGL02056:Foxj3 APN 4 119585757 missense probably damaging 1.00
IGL02455:Foxj3 APN 4 119620237 missense unknown
IGL02542:Foxj3 APN 4 119620343 missense unknown
IGL02625:Foxj3 APN 4 119624917 missense unknown
IGL03216:Foxj3 APN 4 119609983 intron probably benign
R0087:Foxj3 UTSW 4 119626400 missense unknown
R0488:Foxj3 UTSW 4 119619990 nonsense probably null
R0512:Foxj3 UTSW 4 119585836 splice site probably benign
R1531:Foxj3 UTSW 4 119620201 missense unknown
R1799:Foxj3 UTSW 4 119619351 missense probably benign 0.06
R1883:Foxj3 UTSW 4 119610029 missense probably benign 0.20
R3690:Foxj3 UTSW 4 119616642 splice site probably benign
R3691:Foxj3 UTSW 4 119616642 splice site probably benign
R3838:Foxj3 UTSW 4 119616624 missense possibly damaging 0.49
R4065:Foxj3 UTSW 4 119610009 missense probably benign 0.09
R4295:Foxj3 UTSW 4 119626297 nonsense probably null
R4576:Foxj3 UTSW 4 119621663 missense unknown
R4750:Foxj3 UTSW 4 119616590 missense probably damaging 0.99
R4782:Foxj3 UTSW 4 119621660 missense unknown
R4799:Foxj3 UTSW 4 119621660 missense unknown
R5358:Foxj3 UTSW 4 119619399 missense probably damaging 1.00
R5362:Foxj3 UTSW 4 119620143 missense unknown
R5728:Foxj3 UTSW 4 119573762 missense probably damaging 1.00
R5732:Foxj3 UTSW 4 119585811 missense probably damaging 1.00
R6151:Foxj3 UTSW 4 119623271 missense unknown
R6352:Foxj3 UTSW 4 119585778 missense probably damaging 1.00
R6377:Foxj3 UTSW 4 119573748 unclassified probably null
R7034:Foxj3 UTSW 4 119619300 missense probably damaging 0.97
R7672:Foxj3 UTSW 4 119620232 missense unknown
R7912:Foxj3 UTSW 4 119620055 missense possibly damaging 0.63
R7993:Foxj3 UTSW 4 119620055 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- CCACTGGAGTTTATTAGCACCAAG -3'
(R):5'- GGGTGCTGGGGTAAACCATG -3'

Sequencing Primer
(F):5'- AGTTTATTAGCACCAAGTTTGTGG -3'
(R):5'- ACCATGCGGTCTATGGGG -3'
Posted On2016-07-22