Mutagenetix > Incidental Mutation

Incidental Mutation 'R0009:Dnah14'

40449

Institutional Source

Beutler Lab

Gene Symbol

Dnah14

Ensembl Gene

ENSMUSG00000047369

Gene Name

dynein, axonemal, heavy chain 14

Synonyms

Dnahc14, Gm980, LOC381311, A230079K17Rik

MMRRC Submission

038304-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.075) question?

Stock #

R0009 (G1)

Quality Score

159

Status

Validated

Chromosome

Chromosomal Location

181576559-181815774 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 181769407 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000146843 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000208001]

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160345

SMART Domains

Protein: ENSMUSP00000124817
Gene: ENSMUSG00000047369

Domain	Start	End	E-Value	Type
Pfam:MT	46	381	2.1e-41	PFAM
Pfam:AAA_9	401	524	8.3e-35	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000208001

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.7%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A1bg	T	G	15: 60,919,633		probably benign	Het
Abcg4	T	G	9: 44,277,649		probably benign	Het
Afm	C	A	5: 90,545,384		probably benign	Het
Ahrr	G	A	13: 74,283,024		probably benign	Het
Aplnr	T	A	2: 85,137,276		probably null	Het
Arih2	T	A	9: 108,611,727	H264L	probably damaging	Het
Atp1a1	A	T	3: 101,579,835	I886N	possibly damaging	Het
Bmf	A	T	2: 118,549,622	V14E	probably damaging	Het
Ccdc116	T	C	16: 17,144,039	E15G	probably damaging	Het
Ccdc175	T	C	12: 72,135,965	N427D	possibly damaging	Het
Cfap53	A	G	18: 74,299,176	H45R	probably benign	Het
Chd3	A	G	11: 69,349,906	L1569P	probably damaging	Het
Cntn2	G	A	1: 132,516,180	Q457*	probably null	Het
Coro1a	A	T	7: 126,701,413		probably benign	Het
Cracr2b	T	A	7: 141,463,759	L91Q	probably damaging	Het
Ctdspl	T	C	9: 119,020,046		probably null	Het
Dip2b	T	A	15: 100,169,312	L565Q	probably damaging	Het
Dip2c	T	A	13: 9,621,903	C1004S	probably damaging	Het
Dnah11	A	T	12: 118,045,522	I2135N	possibly damaging	Het
Dnase1	T	C	16: 4,038,946	V147A	probably damaging	Het
Dusp8	T	C	7: 142,082,054		probably benign	Het
Fer1l6	T	C	15: 58,662,787	Y1828H	probably damaging	Het
Flvcr1	A	G	1: 191,008,191	V544A	probably benign	Het
Fsd1l	T	C	4: 53,687,209	V311A	probably benign	Het
Glud1	G	A	14: 34,334,268	G300S	probably benign	Het
Gm4847	C	T	1: 166,630,486	V433I	probably benign	Het
Gstm3	T	G	3: 107,967,840	Y62S	probably damaging	Het
Gtse1	C	T	15: 85,862,435	P151S	probably benign	Het
Herc2	T	C	7: 56,207,812	S4048P	probably benign	Het
Hp1bp3	T	A	4: 138,221,683	I19K	probably benign	Het
Htr7	C	A	19: 36,041,540		probably benign	Het
Il1a	C	T	2: 129,309,074	D10N	probably damaging	Het
Il22ra2	A	T	10: 19,624,458	N39I	probably damaging	Het
Kcnn4	T	C	7: 24,379,255	C267R	possibly damaging	Het
Larp1	A	G	11: 58,055,473	K879R	possibly damaging	Het
Lcn5	T	A	2: 25,661,405		probably benign	Het
Lep	T	A	6: 29,068,972	C7*	probably null	Het
Magi2	A	T	5: 20,611,055	Y747F	probably benign	Het
Mast4	T	C	13: 102,742,058	T1223A	probably damaging	Het
Mcc	C	T	18: 44,445,933	E803K	probably damaging	Het
Mtmr4	T	C	11: 87,611,508	I796T	probably benign	Het
Myef2	A	T	2: 125,108,978	D312E	probably benign	Het
Myl3	A	C	9: 110,767,929	D119A	probably damaging	Het
Myo19	T	A	11: 84,888,169		probably null	Het
Naa15	T	G	3: 51,470,219	H763Q	probably damaging	Het
Pde5a	C	T	3: 122,824,902		probably benign	Het
Plpp2	C	T	10: 79,527,244	R184H	probably benign	Het
Rab19	T	G	6: 39,389,687	L179V	probably damaging	Het
Rims2	T	A	15: 39,534,966	M1087K	probably damaging	Het
Riox2	C	A	16: 59,489,367	D361E	probably benign	Het
Sh3rf1	T	A	8: 61,226,293	V123E	probably damaging	Het
Slc35e1	A	T	8: 72,484,709	N318K	probably damaging	Het
Slc9a2	A	T	1: 40,763,602	E604V	probably benign	Het
Srp72	T	C	5: 76,987,885	S221P	probably damaging	Het
Tbx19	A	T	1: 165,160,520	S15T	possibly damaging	Het
Tcea2	A	G	2: 181,685,817	T112A	probably benign	Het
Tesk1	T	A	4: 43,445,368	D230E	probably damaging	Het
Tm4sf5	C	T	11: 70,510,712	A179V	probably damaging	Het
Tnr	G	T	1: 159,852,416	G320V	probably damaging	Het
Trappc11	A	T	8: 47,503,320	C874S	possibly damaging	Het
Trpm3	T	A	19: 22,914,446	Y885N	probably damaging	Het
Unc5a	T	A	13: 55,002,879	C505S	probably damaging	Het
Vmn1r28	G	A	6: 58,265,717	A182T	probably benign	Het
Xpo5	T	C	17: 46,204,786		probably benign	Het
Zfp637	C	A	6: 117,845,668	H252Q	probably damaging	Het
Zfp646	T	A	7: 127,880,731	D693E	probably damaging	Het

Other mutations in Dnah14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01086:Dnah14	APN	1	181752046	missense	probably benign	0.17
IGL01764:Dnah14	APN	1	181744777	missense	probably benign	0.00
IGL03218:Dnah14	APN	1	181755269	missense	probably benign	0.02
IGL03290:Dnah14	APN	1	181763978	splice site	probably benign
IGL03384:Dnah14	APN	1	181745949	missense	probably benign	0.03
R0125:Dnah14	UTSW	1	181752063	missense	probably damaging	0.99
R0579:Dnah14	UTSW	1	181744747	missense	possibly damaging	0.72
R0973:Dnah14	UTSW	1	181752145	missense	probably damaging	1.00
R0973:Dnah14	UTSW	1	181752145	missense	probably damaging	1.00
R0974:Dnah14	UTSW	1	181752145	missense	probably damaging	1.00
R1609:Dnah14	UTSW	1	181750177	missense	probably damaging	0.97
R1860:Dnah14	UTSW	1	181763960	missense	probably damaging	1.00
R2050:Dnah14	UTSW	1	181752562	missense	probably damaging	1.00
R2974:Dnah14	UTSW	1	181755241	critical splice acceptor site	probably null
R4715:Dnah14	UTSW	1	181757223	missense	probably damaging	1.00
R5076:Dnah14	UTSW	1	181757234	missense	probably benign	0.01
R5424:Dnah14	UTSW	1	181763310	missense	possibly damaging	0.95
R5808:Dnah14	UTSW	1	181741159	missense	possibly damaging	0.72
R5997:Dnah14	UTSW	1	181770105	missense	probably benign	0.00
R6052:Dnah14	UTSW	1	181666487	missense	possibly damaging	0.50
R6061:Dnah14	UTSW	1	181709051	missense	probably damaging	1.00
R6089:Dnah14	UTSW	1	181750154	missense	probably damaging	1.00
R6092:Dnah14	UTSW	1	181621833	missense	probably benign	0.13
R6145:Dnah14	UTSW	1	181666417	missense	probably benign	0.00
R6163:Dnah14	UTSW	1	181666361	missense	probably benign	0.33
R6246:Dnah14	UTSW	1	181680888	missense	probably benign	0.00
R6302:Dnah14	UTSW	1	181601206	missense	possibly damaging	0.96
R6306:Dnah14	UTSW	1	181585024	frame shift	probably null
R6326:Dnah14	UTSW	1	181783556	missense	probably damaging	1.00
R6348:Dnah14	UTSW	1	181626720	missense	possibly damaging	0.83
R6367:Dnah14	UTSW	1	181755386	splice site	probably null
R6376:Dnah14	UTSW	1	181605894	missense	possibly damaging	0.79
R6389:Dnah14	UTSW	1	181651202	critical splice donor site	probably null
R6433:Dnah14	UTSW	1	181651657	missense	probably damaging	0.99
R6454:Dnah14	UTSW	1	181783705	missense	probably damaging	1.00
R6476:Dnah14	UTSW	1	181744768	missense	probably benign	0.26
R6523:Dnah14	UTSW	1	181643621	missense	probably benign	0.00
R6529:Dnah14	UTSW	1	181666469	missense	probably damaging	0.98
R6538:Dnah14	UTSW	1	181584985	missense	unknown
R6546:Dnah14	UTSW	1	181738987	missense	probably damaging	1.00
R6752:Dnah14	UTSW	1	181593452	missense	probably benign	0.07
R6762:Dnah14	UTSW	1	181757259	missense	probably damaging	1.00
R6786:Dnah14	UTSW	1	181641405	missense	probably benign	0.21
R6849:Dnah14	UTSW	1	181808945	missense	probably benign	0.00
R6877:Dnah14	UTSW	1	181628432	missense	possibly damaging	0.82
R6912:Dnah14	UTSW	1	181750183	missense	possibly damaging	0.83
R6919:Dnah14	UTSW	1	181585066	missense	probably benign	0.04
R6924:Dnah14	UTSW	1	181627952	missense	probably benign	0.04
R6957:Dnah14	UTSW	1	181785175	missense	possibly damaging	0.92
R6980:Dnah14	UTSW	1	181648230	missense	probably benign	0.00
R7018:Dnah14	UTSW	1	181626944	missense	possibly damaging	0.55
R7046:Dnah14	UTSW	1	181623003	missense	probably benign	0.01
R7058:Dnah14	UTSW	1	181698049	missense	probably benign	0.00
R7068:Dnah14	UTSW	1	181769790	missense	probably benign	0.35
R7115:Dnah14	UTSW	1	181720145	missense	probably damaging	1.00
R7130:Dnah14	UTSW	1	181745958	nonsense	probably null
R7165:Dnah14	UTSW	1	181704535	missense	probably benign	0.00
R7169:Dnah14	UTSW	1	181702365	missense	probably benign	0.00
R7184:Dnah14	UTSW	1	181704529	nonsense	probably null
R7232:Dnah14	UTSW	1	181757363	missense	probably damaging	1.00
R7260:Dnah14	UTSW	1	181706744	missense	probably damaging	0.99
R7276:Dnah14	UTSW	1	181685807	missense	probably benign	0.41
R7290:Dnah14	UTSW	1	181628174	missense	probably benign	0.20
R7314:Dnah14	UTSW	1	181785254	splice site	probably null
R7326:Dnah14	UTSW	1	181598403	missense	probably benign	0.02
R7336:Dnah14	UTSW	1	181797734	missense	probably damaging	0.96
R7363:Dnah14	UTSW	1	181690524	splice site	probably null
R7371:Dnah14	UTSW	1	181626885	missense	probably benign	0.05
R7376:Dnah14	UTSW	1	181763402	missense	probably benign	0.03
R7418:Dnah14	UTSW	1	181616742	missense	possibly damaging	0.92
R7473:Dnah14	UTSW	1	181752139	missense	probably damaging	0.99
R7514:Dnah14	UTSW	1	181628067	missense	probably damaging	0.96
R7555:Dnah14	UTSW	1	181770054	missense	probably benign	0.26
R7641:Dnah14	UTSW	1	181707533	missense	probably benign	0.01
R7663:Dnah14	UTSW	1	181752155	splice site	probably null
R7674:Dnah14	UTSW	1	181707533	missense	probably benign	0.01
R7680:Dnah14	UTSW	1	181685800	missense	probably benign	0.15
R7709:Dnah14	UTSW	1	181702484	critical splice donor site	probably null
R7842:Dnah14	UTSW	1	181627898	missense	probably damaging	0.99
R7861:Dnah14	UTSW	1	181616759	missense	probably damaging	1.00
R7988:Dnah14	UTSW	1	181783574	missense	probably damaging	0.97
R8016:Dnah14	UTSW	1	181648311	missense	probably benign	0.05
R8042:Dnah14	UTSW	1	181643631	critical splice donor site	probably null
R8071:Dnah14	UTSW	1	181615894	missense	possibly damaging	0.84
R8086:Dnah14	UTSW	1	181766232	missense	probably damaging	1.00
R8095:Dnah14	UTSW	1	181806032	nonsense	probably null
R8139:Dnah14	UTSW	1	181755288	missense	probably damaging	1.00
R8176:Dnah14	UTSW	1	181657033	missense	probably damaging	0.96
R8193:Dnah14	UTSW	1	181688205	missense	probably damaging	1.00
R8197:Dnah14	UTSW	1	181690101	missense	possibly damaging	0.94
R8209:Dnah14	UTSW	1	181795545	missense	possibly damaging	0.69
R8226:Dnah14	UTSW	1	181795545	missense	possibly damaging	0.69
R8251:Dnah14	UTSW	1	181664865	missense	probably damaging	1.00
R8264:Dnah14	UTSW	1	181744792	missense	probably damaging	0.99
R8284:Dnah14	UTSW	1	181773811	missense	probably benign	0.03
R8289:Dnah14	UTSW	1	181716215	nonsense	probably null
R8323:Dnah14	UTSW	1	181704544	missense	probably benign	0.01
R8442:Dnah14	UTSW	1	181741284	missense	probably damaging	0.97
R8458:Dnah14	UTSW	1	181806012	missense
R8507:Dnah14	UTSW	1	181641414	missense	probably benign	0.02
R8509:Dnah14	UTSW	1	181814655	missense
R8520:Dnah14	UTSW	1	181653638	missense	probably damaging	1.00
R8530:Dnah14	UTSW	1	181664946	missense	probably damaging	1.00
R8703:Dnah14	UTSW	1	181666011	nonsense	probably null
R8710:Dnah14	UTSW	1	181690311	missense	probably benign	0.04
R8752:Dnah14	UTSW	1	181628016	missense	probably benign	0.00
R8792:Dnah14	UTSW	1	181814624	missense
R8797:Dnah14	UTSW	1	181637847	missense	probably benign	0.19
R8821:Dnah14	UTSW	1	181792004	nonsense	probably null
R8834:Dnah14	UTSW	1	181616750	missense	possibly damaging	0.83
R8913:Dnah14	UTSW	1	181725498	missense	probably benign	0.01
R8925:Dnah14	UTSW	1	181680756	missense	probably damaging	1.00
R8927:Dnah14	UTSW	1	181680756	missense	probably damaging	1.00
R8934:Dnah14	UTSW	1	181622723	missense	possibly damaging	0.84
R9090:Dnah14	UTSW	1	181769760	missense	probably benign	0.33
R9169:Dnah14	UTSW	1	181605816	missense	probably benign	0.06
R9199:Dnah14	UTSW	1	181651001	missense	possibly damaging	0.50
R9212:Dnah14	UTSW	1	181801287	missense	possibly damaging	0.95
R9213:Dnah14	UTSW	1	181616640	critical splice donor site	probably null
R9271:Dnah14	UTSW	1	181769760	missense	probably benign	0.33
R9282:Dnah14	UTSW	1	181814512	missense
R9350:Dnah14	UTSW	1	181734804	missense	possibly damaging	0.79
R9358:Dnah14	UTSW	1	181709033	missense	probably benign	0.01
R9436:Dnah14	UTSW	1	181680783	missense	probably damaging	1.00
R9484:Dnah14	UTSW	1	181690208	missense	probably benign	0.45
R9484:Dnah14	UTSW	1	181797746	missense	probably benign	0.01
R9486:Dnah14	UTSW	1	181680929	missense	possibly damaging	0.68
R9546:Dnah14	UTSW	1	181593427	critical splice acceptor site	probably null
R9547:Dnah14	UTSW	1	181593427	critical splice acceptor site	probably null
R9578:Dnah14	UTSW	1	181674442	missense	probably benign	0.16
RF007:Dnah14	UTSW	1	181685809	missense	probably benign	0.00
RF012:Dnah14	UTSW	1	181627898	missense	probably damaging	0.99
Z1176:Dnah14	UTSW	1	181757351	missense	possibly damaging	0.83
Z1177:Dnah14	UTSW	1	181690320	missense	probably benign	0.03
Z1177:Dnah14	UTSW	1	181763334	missense	probably damaging	1.00
Z1177:Dnah14	UTSW	1	181766304	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCTCTGGAATCCGAGCCCATGAC -3'
(R):5'- AACTGGTACATCTTCTCCACATGCG -3'

Sequencing Primer
(F):5'- AGCCCATGACTGCCTCTG -3'
(R):5'- TTCTCCACATGCGAGAGGC -3'

Posted On

2013-05-23