Incidental Mutation 'R5305:Areg'
ID404491
Institutional Source Beutler Lab
Gene Symbol Areg
Ensembl Gene ENSMUSG00000029378
Gene Nameamphiregulin
SynonymsAR, Sdgf
MMRRC Submission 042888-MU
Accession Numbers

MGI: 88068; Ncbi RefSeq: NM_009704

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5305 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location91139599-91148432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 91144449 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 203 (A203S)
Ref Sequence ENSEMBL: ENSMUSP00000031325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031325]
Predicted Effect probably damaging
Transcript: ENSMUST00000031325
AA Change: A203S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031325
Gene: ENSMUSG00000029378
AA Change: A203S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
EGF 138 175 7.41e0 SMART
transmembrane domain 193 215 N/A INTRINSIC
low complexity region 222 240 N/A INTRINSIC
Meta Mutation Damage Score 0.2133 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: This gene encodes a member of the epidermal growth factor (EGF) family and preproprotein that is proteolytically processed to generate a mature protein product. The encoded protein is a ligand of the epidermal growth factor receptor (EGFR) and has been shown to play a role in immunity, inflammation, tissue repair, and lung and mammary gland development. Homozygous knockout mice for this gene exhibit impaired immune system regulation in the skin and gene expression changes characteristic of chronic liver damage. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired development of mammary gland ducts in pubescent females. Mutant ducts show retarded elongation with few terminal end buds. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G A 15: 82,059,219 V11M possibly damaging Het
Acot8 A G 2: 164,795,765 V179A probably benign Het
Actb A G 5: 142,904,230 I194T probably benign Het
Ap1g2 A G 14: 55,099,076 V787A probably benign Het
Asb13 A T 13: 3,643,479 D79V probably damaging Het
Atad2b C T 12: 4,965,855 T527I probably damaging Het
Auts2 T G 5: 131,443,794 probably benign Het
Ceacam3 T A 7: 17,151,576 S35T probably damaging Het
Crebzf T C 7: 90,444,134 probably benign Het
Cttnbp2 G T 6: 18,381,098 N1366K probably benign Het
Cubn C A 2: 13,388,939 C1417F probably damaging Het
Dot1l C T 10: 80,790,793 P162S probably benign Het
Epc1 G A 18: 6,490,690 probably benign Het
Eps8l1 A G 7: 4,477,896 S613G possibly damaging Het
Erich6 T G 3: 58,625,116 I357L probably benign Het
Foxj3 T A 4: 119,619,958 S288T possibly damaging Het
Gls2 T G 10: 128,204,709 Y326* probably null Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm7535 T C 17: 17,911,799 probably benign Het
Gxylt2 T G 6: 100,787,218 L288R probably damaging Het
Kdm4a T C 4: 118,160,501 Y456C probably damaging Het
Mgat4c T A 10: 102,389,279 F451L possibly damaging Het
Mrpl20 G A 4: 155,803,705 R17H probably damaging Het
Mtf2 A G 5: 108,104,499 T465A possibly damaging Het
Mycbp2 A C 14: 103,346,321 L66R probably benign Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Nr2e1 A T 10: 42,571,487 Y176* probably null Het
Obscn T C 11: 59,012,715 T7628A possibly damaging Het
Olfr1353 A T 10: 78,970,556 K302N possibly damaging Het
Pitx2 T G 3: 129,215,840 V129G probably damaging Het
Polr2e A G 10: 80,038,063 probably benign Het
Ppard A G 17: 28,298,858 D300G probably damaging Het
Ppp1r27 A G 11: 120,550,917 V46A probably benign Het
Prex2 T A 1: 11,107,678 V332E probably damaging Het
Prss30 T G 17: 23,972,776 Y257S probably benign Het
Ptprd T C 4: 75,982,626 E1082G probably damaging Het
Rab3c T A 13: 110,181,077 R89S probably damaging Het
Rimbp2 A G 5: 128,797,381 V389A possibly damaging Het
Rims1 T A 1: 22,596,542 R119S probably damaging Het
Sema3b T C 9: 107,603,337 H137R probably null Het
Sf3b4 G C 3: 96,173,642 A89P probably damaging Het
Sgta T A 10: 81,046,247 Q298L probably damaging Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Sry T A Y: 2,662,982 D226V unknown Het
Sv2a A G 3: 96,185,458 E158G possibly damaging Het
Sytl2 A G 7: 90,381,863 probably benign Het
Thbs3 T A 3: 89,217,976 probably benign Het
Top3a A T 11: 60,762,539 N56K possibly damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Tyk2 T C 9: 21,109,381 D918G probably damaging Het
Uqcrh A G 4: 116,067,284 probably benign Het
Vmn1r61 A G 7: 5,610,815 S167P probably damaging Het
Wdr25 C A 12: 109,026,440 H74N probably damaging Het
Zfp458 T C 13: 67,256,318 N686D probably benign Het
Zfp574 T A 7: 25,081,090 H512Q probably damaging Het
Zfp976 A T 7: 42,613,478 Y312N probably benign Het
Zscan4c G A 7: 11,009,535 V354I probably benign Het
Other mutations in Areg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Areg APN 5 91141095 missense probably damaging 0.99
IGL01929:Areg APN 5 91144453 missense probably benign
IGL01971:Areg APN 5 91141011 missense probably benign 0.03
IGL02250:Areg APN 5 91141108 missense possibly damaging 0.83
R1436:Areg UTSW 5 91139805 start gained probably benign
R1674:Areg UTSW 5 91143626 missense probably damaging 0.96
R1699:Areg UTSW 5 91143498 missense probably damaging 1.00
R4239:Areg UTSW 5 91143516 missense probably damaging 1.00
R4240:Areg UTSW 5 91143516 missense probably damaging 1.00
R4613:Areg UTSW 5 91143504 missense probably benign 0.34
R4738:Areg UTSW 5 91146724 missense possibly damaging 0.91
R5040:Areg UTSW 5 91144339 missense possibly damaging 0.94
R5987:Areg UTSW 5 91146718 missense possibly damaging 0.83
R6075:Areg UTSW 5 91143597 missense probably damaging 0.99
R7210:Areg UTSW 5 91140905 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATGGCGTGACCTCTCTATGTTC -3'
(R):5'- GTCAAAGGAATGCAAGGTTTGATTC -3'

Sequencing Primer
(F):5'- AGTGACCGTATCATTAGGTAGTATG -3'
(R):5'- GATTCTATTCTGCTCAGGGGTCAC -3'
Posted On2016-07-22