Incidental Mutation 'R5305:Rimbp2'
ID404493
Institutional Source Beutler Lab
Gene Symbol Rimbp2
Ensembl Gene ENSMUSG00000029420
Gene NameRIMS binding protein 2
Synonyms
MMRRC Submission 042888-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5305 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location128757791-128953486 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128797381 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 389 (V389A)
Ref Sequence ENSEMBL: ENSMUSP00000142455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111346] [ENSMUST00000196085] [ENSMUST00000198941] [ENSMUST00000199537] [ENSMUST00000200470]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111346
AA Change: V389A

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106978
Gene: ENSMUSG00000029420
AA Change: V389A

DomainStartEndE-ValueType
coiled coil region 1 84 N/A INTRINSIC
low complexity region 178 187 N/A INTRINSIC
SH3 191 254 1.61e-11 SMART
FN3 318 398 1.52e-1 SMART
FN3 412 484 3.59e-3 SMART
FN3 508 594 3.08e-2 SMART
low complexity region 598 624 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
low complexity region 774 795 N/A INTRINSIC
low complexity region 826 842 N/A INTRINSIC
SH3 878 942 5.24e-11 SMART
SH3 982 1045 7.17e-18 SMART
Predicted Effect unknown
Transcript: ENSMUST00000196085
AA Change: V389A
SMART Domains Protein: ENSMUSP00000143725
Gene: ENSMUSG00000029420
AA Change: V389A

DomainStartEndE-ValueType
coiled coil region 1 84 N/A INTRINSIC
low complexity region 178 187 N/A INTRINSIC
SH3 191 254 1e-13 SMART
FN3 318 398 7.7e-4 SMART
FN3 412 484 1.7e-5 SMART
FN3 508 594 1.6e-4 SMART
low complexity region 598 624 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
low complexity region 699 720 N/A INTRINSIC
low complexity region 751 767 N/A INTRINSIC
SH3 803 867 3.2e-13 SMART
SH3 907 970 4.5e-20 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000198941
AA Change: V389A

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142455
Gene: ENSMUSG00000029420
AA Change: V389A

DomainStartEndE-ValueType
coiled coil region 1 84 N/A INTRINSIC
low complexity region 178 187 N/A INTRINSIC
SH3 191 254 1.61e-11 SMART
FN3 318 398 1.52e-1 SMART
FN3 412 484 3.59e-3 SMART
FN3 508 594 3.08e-2 SMART
low complexity region 598 624 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
low complexity region 774 795 N/A INTRINSIC
low complexity region 826 842 N/A INTRINSIC
SH3 878 942 5.24e-11 SMART
SH3 982 1045 7.17e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000199537
AA Change: V382A

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000143276
Gene: ENSMUSG00000029420
AA Change: V382A

DomainStartEndE-ValueType
coiled coil region 1 77 N/A INTRINSIC
low complexity region 171 180 N/A INTRINSIC
SH3 184 247 1.61e-11 SMART
FN3 311 391 1.52e-1 SMART
FN3 405 477 3.59e-3 SMART
FN3 501 587 3.08e-2 SMART
low complexity region 591 617 N/A INTRINSIC
low complexity region 660 670 N/A INTRINSIC
low complexity region 767 788 N/A INTRINSIC
low complexity region 819 835 N/A INTRINSIC
SH3 871 935 5.24e-11 SMART
SH3 975 1038 7.17e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000200470
AA Change: V382A

PolyPhen 2 Score 0.459 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143099
Gene: ENSMUSG00000029420
AA Change: V382A

DomainStartEndE-ValueType
coiled coil region 1 77 N/A INTRINSIC
low complexity region 171 180 N/A INTRINSIC
SH3 184 247 9.8e-14 SMART
FN3 311 391 7.5e-4 SMART
FN3 405 477 1.7e-5 SMART
FN3 501 587 1.5e-4 SMART
low complexity region 591 617 N/A INTRINSIC
low complexity region 660 670 N/A INTRINSIC
low complexity region 767 788 N/A INTRINSIC
low complexity region 819 835 N/A INTRINSIC
SH3 871 935 3.2e-13 SMART
SH3 975 1038 4.4e-20 SMART
Meta Mutation Damage Score 0.3576 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (67/68)
MGI Phenotype PHENOTYPE: Homozygous knockout results in a mild neurological phenotype with changes in the synaptic transmission and plasticity of hippocampal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G A 15: 82,059,219 V11M possibly damaging Het
Acot8 A G 2: 164,795,765 V179A probably benign Het
Actb A G 5: 142,904,230 I194T probably benign Het
Ap1g2 A G 14: 55,099,076 V787A probably benign Het
Areg G T 5: 91,144,449 A203S probably damaging Het
Asb13 A T 13: 3,643,479 D79V probably damaging Het
Atad2b C T 12: 4,965,855 T527I probably damaging Het
Auts2 T G 5: 131,443,794 probably benign Het
Ceacam3 T A 7: 17,151,576 S35T probably damaging Het
Crebzf T C 7: 90,444,134 probably benign Het
Cttnbp2 G T 6: 18,381,098 N1366K probably benign Het
Cubn C A 2: 13,388,939 C1417F probably damaging Het
Dot1l C T 10: 80,790,793 P162S probably benign Het
Epc1 G A 18: 6,490,690 probably benign Het
Eps8l1 A G 7: 4,477,896 S613G possibly damaging Het
Erich6 T G 3: 58,625,116 I357L probably benign Het
Foxj3 T A 4: 119,619,958 S288T possibly damaging Het
Gls2 T G 10: 128,204,709 Y326* probably null Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm7535 T C 17: 17,911,799 probably benign Het
Gxylt2 T G 6: 100,787,218 L288R probably damaging Het
Kdm4a T C 4: 118,160,501 Y456C probably damaging Het
Mgat4c T A 10: 102,389,279 F451L possibly damaging Het
Mrpl20 G A 4: 155,803,705 R17H probably damaging Het
Mtf2 A G 5: 108,104,499 T465A possibly damaging Het
Mycbp2 A C 14: 103,346,321 L66R probably benign Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Nr2e1 A T 10: 42,571,487 Y176* probably null Het
Obscn T C 11: 59,012,715 T7628A possibly damaging Het
Olfr1353 A T 10: 78,970,556 K302N possibly damaging Het
Pitx2 T G 3: 129,215,840 V129G probably damaging Het
Polr2e A G 10: 80,038,063 probably benign Het
Ppard A G 17: 28,298,858 D300G probably damaging Het
Ppp1r27 A G 11: 120,550,917 V46A probably benign Het
Prex2 T A 1: 11,107,678 V332E probably damaging Het
Prss30 T G 17: 23,972,776 Y257S probably benign Het
Ptprd T C 4: 75,982,626 E1082G probably damaging Het
Rab3c T A 13: 110,181,077 R89S probably damaging Het
Rims1 T A 1: 22,596,542 R119S probably damaging Het
Sema3b T C 9: 107,603,337 H137R probably null Het
Sf3b4 G C 3: 96,173,642 A89P probably damaging Het
Sgta T A 10: 81,046,247 Q298L probably damaging Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Sry T A Y: 2,662,982 D226V unknown Het
Sv2a A G 3: 96,185,458 E158G possibly damaging Het
Sytl2 A G 7: 90,381,863 probably benign Het
Thbs3 T A 3: 89,217,976 probably benign Het
Top3a A T 11: 60,762,539 N56K possibly damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Tyk2 T C 9: 21,109,381 D918G probably damaging Het
Uqcrh A G 4: 116,067,284 probably benign Het
Vmn1r61 A G 7: 5,610,815 S167P probably damaging Het
Wdr25 C A 12: 109,026,440 H74N probably damaging Het
Zfp458 T C 13: 67,256,318 N686D probably benign Het
Zfp574 T A 7: 25,081,090 H512Q probably damaging Het
Zfp976 A T 7: 42,613,478 Y312N probably benign Het
Zscan4c G A 7: 11,009,535 V354I probably benign Het
Other mutations in Rimbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Rimbp2 APN 5 128806441 missense probably benign 0.00
IGL01321:Rimbp2 APN 5 128786752 missense probably benign 0.10
IGL01459:Rimbp2 APN 5 128788211 critical splice donor site probably null
IGL01743:Rimbp2 APN 5 128797848 splice site probably benign
IGL01975:Rimbp2 APN 5 128797648 missense probably benign 0.30
IGL02269:Rimbp2 APN 5 128774295 missense probably damaging 1.00
IGL02341:Rimbp2 APN 5 128800961 nonsense probably null
IGL02368:Rimbp2 APN 5 128788154 splice site probably null
IGL02392:Rimbp2 APN 5 128771797 missense probably benign 0.01
IGL03156:Rimbp2 APN 5 128771757 missense probably damaging 1.00
IGL02837:Rimbp2 UTSW 5 128797745 missense probably damaging 0.98
PIT4418001:Rimbp2 UTSW 5 128780361 missense probably benign 0.00
R0193:Rimbp2 UTSW 5 128788356 missense probably benign 0.12
R0376:Rimbp2 UTSW 5 128803861 missense probably damaging 0.98
R0377:Rimbp2 UTSW 5 128803861 missense probably damaging 0.98
R0661:Rimbp2 UTSW 5 128786710 missense probably benign 0.20
R1217:Rimbp2 UTSW 5 128788287 missense probably benign 0.04
R1376:Rimbp2 UTSW 5 128770291 missense possibly damaging 0.75
R1376:Rimbp2 UTSW 5 128770291 missense possibly damaging 0.75
R1551:Rimbp2 UTSW 5 128806359 missense probably damaging 0.97
R1883:Rimbp2 UTSW 5 128803934 missense possibly damaging 0.93
R1970:Rimbp2 UTSW 5 128797241 missense probably damaging 1.00
R2111:Rimbp2 UTSW 5 128773501 missense probably damaging 1.00
R2120:Rimbp2 UTSW 5 128788518 missense probably damaging 1.00
R2155:Rimbp2 UTSW 5 128788165 missense probably damaging 0.99
R2332:Rimbp2 UTSW 5 128789641 missense probably benign 0.42
R2370:Rimbp2 UTSW 5 128803844 missense probably damaging 0.99
R2402:Rimbp2 UTSW 5 128784888 missense probably damaging 1.00
R3710:Rimbp2 UTSW 5 128789731 missense probably benign 0.16
R3877:Rimbp2 UTSW 5 128773465 missense probably damaging 1.00
R3974:Rimbp2 UTSW 5 128797798 missense probably damaging 1.00
R4257:Rimbp2 UTSW 5 128774260 missense probably damaging 1.00
R4270:Rimbp2 UTSW 5 128819777 missense probably benign
R4271:Rimbp2 UTSW 5 128819777 missense probably benign
R4281:Rimbp2 UTSW 5 128788340 missense possibly damaging 0.82
R4934:Rimbp2 UTSW 5 128788515 missense probably benign 0.12
R5011:Rimbp2 UTSW 5 128803921 missense probably damaging 0.98
R5173:Rimbp2 UTSW 5 128797648 missense probably benign 0.30
R5288:Rimbp2 UTSW 5 128788592 missense probably benign 0.00
R5554:Rimbp2 UTSW 5 128780342 missense probably damaging 0.98
R6189:Rimbp2 UTSW 5 128803897 missense probably benign
R7023:Rimbp2 UTSW 5 128802783 critical splice donor site probably null
R7096:Rimbp2 UTSW 5 128774269 missense probably damaging 0.99
R7451:Rimbp2 UTSW 5 128788371 missense probably benign 0.00
R7789:Rimbp2 UTSW 5 128774335 missense probably damaging 0.99
R7793:Rimbp2 UTSW 5 128789695 missense possibly damaging 0.92
R7894:Rimbp2 UTSW 5 128761464 missense probably damaging 1.00
R7977:Rimbp2 UTSW 5 128761464 missense probably damaging 1.00
Z1177:Rimbp2 UTSW 5 128761339 missense probably benign 0.07
Z1177:Rimbp2 UTSW 5 128773451 missense probably benign 0.01
Z1177:Rimbp2 UTSW 5 128788180 missense probably damaging 1.00
Z1177:Rimbp2 UTSW 5 128797607 missense probably damaging 1.00
Z1177:Rimbp2 UTSW 5 128797631 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGAATTGGTACTTGTACCTGGC -3'
(R):5'- GCTTGCCAAAAGTGTCATCG -3'

Sequencing Primer
(F):5'- TGGCTGCCTTCACGATG -3'
(R):5'- CCAAAAGTGTCATCGTGGGCTG -3'
Posted On2016-07-22