Incidental Mutation 'R5305:Actb'
ID404495
Institutional Source Beutler Lab
Gene Symbol Actb
Ensembl Gene ENSMUSG00000029580
Gene Nameactin, beta
SynonymsActx, A-X actin-like protein, E430023M04Rik, beta-actin
MMRRC Submission 042888-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5305 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location142903115-142906754 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 142904230 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 194 (I194T)
Ref Sequence ENSEMBL: ENSMUSP00000127663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100497] [ENSMUST00000106216] [ENSMUST00000163829] [ENSMUST00000167721] [ENSMUST00000171419]
Predicted Effect probably benign
Transcript: ENSMUST00000100497
AA Change: I274T

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000098066
Gene: ENSMUSG00000029580
AA Change: I274T

DomainStartEndE-ValueType
ACTIN 5 375 1.67e-243 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106216
SMART Domains Protein: ENSMUSP00000101823
Gene: ENSMUSG00000029580

DomainStartEndE-ValueType
ACTIN 8 150 8.66e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163829
SMART Domains Protein: ENSMUSP00000132135
Gene: ENSMUSG00000029580

DomainStartEndE-ValueType
Pfam:Actin 2 58 8.5e-18 PFAM
Pfam:Actin 52 108 6.8e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165629
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167386
Predicted Effect probably benign
Transcript: ENSMUST00000167721
AA Change: I194T

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000127663
Gene: ENSMUSG00000029580
AA Change: I194T

DomainStartEndE-ValueType
ACTIN 5 295 1.84e-149 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171419
SMART Domains Protein: ENSMUSP00000130611
Gene: ENSMUSG00000029580

DomainStartEndE-ValueType
ACTIN 5 265 3.43e-117 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196997
Meta Mutation Damage Score 0.9424 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: This gene encodes a member of the actin family of proteins. Actins are highly conserved proteins that are among the most abundant proteins in eukaryotic cells and are involved in cell motility, structure, and integrity. Localization, stability, and translation of the transcribed mRNA are regulated through the binding of multiple factors to its 3' UTR sequence. Homozygous knockout mice for this gene exhibit embryonic lethality. Numerous pseudogenes of this gene have been identified in the mouse genome. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mutants are embryonic lethal. Homozygotes for a hypomorphic targeted mutation develop normally until embryonic day 8.5; are growth retarded by day 9.5 and die shortly thereafter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G A 15: 82,059,219 V11M possibly damaging Het
Acot8 A G 2: 164,795,765 V179A probably benign Het
Ap1g2 A G 14: 55,099,076 V787A probably benign Het
Areg G T 5: 91,144,449 A203S probably damaging Het
Asb13 A T 13: 3,643,479 D79V probably damaging Het
Atad2b C T 12: 4,965,855 T527I probably damaging Het
Auts2 T G 5: 131,443,794 probably benign Het
Ceacam3 T A 7: 17,151,576 S35T probably damaging Het
Crebzf T C 7: 90,444,134 probably benign Het
Cttnbp2 G T 6: 18,381,098 N1366K probably benign Het
Cubn C A 2: 13,388,939 C1417F probably damaging Het
Dot1l C T 10: 80,790,793 P162S probably benign Het
Epc1 G A 18: 6,490,690 probably benign Het
Eps8l1 A G 7: 4,477,896 S613G possibly damaging Het
Erich6 T G 3: 58,625,116 I357L probably benign Het
Foxj3 T A 4: 119,619,958 S288T possibly damaging Het
Gls2 T G 10: 128,204,709 Y326* probably null Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm7535 T C 17: 17,911,799 probably benign Het
Gxylt2 T G 6: 100,787,218 L288R probably damaging Het
Kdm4a T C 4: 118,160,501 Y456C probably damaging Het
Mgat4c T A 10: 102,389,279 F451L possibly damaging Het
Mrpl20 G A 4: 155,803,705 R17H probably damaging Het
Mtf2 A G 5: 108,104,499 T465A possibly damaging Het
Mycbp2 A C 14: 103,346,321 L66R probably benign Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Nr2e1 A T 10: 42,571,487 Y176* probably null Het
Obscn T C 11: 59,012,715 T7628A possibly damaging Het
Olfr1353 A T 10: 78,970,556 K302N possibly damaging Het
Pitx2 T G 3: 129,215,840 V129G probably damaging Het
Polr2e A G 10: 80,038,063 probably benign Het
Ppard A G 17: 28,298,858 D300G probably damaging Het
Ppp1r27 A G 11: 120,550,917 V46A probably benign Het
Prex2 T A 1: 11,107,678 V332E probably damaging Het
Prss30 T G 17: 23,972,776 Y257S probably benign Het
Ptprd T C 4: 75,982,626 E1082G probably damaging Het
Rab3c T A 13: 110,181,077 R89S probably damaging Het
Rimbp2 A G 5: 128,797,381 V389A possibly damaging Het
Rims1 T A 1: 22,596,542 R119S probably damaging Het
Sema3b T C 9: 107,603,337 H137R probably null Het
Sf3b4 G C 3: 96,173,642 A89P probably damaging Het
Sgta T A 10: 81,046,247 Q298L probably damaging Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Sry T A Y: 2,662,982 D226V unknown Het
Sv2a A G 3: 96,185,458 E158G possibly damaging Het
Sytl2 A G 7: 90,381,863 probably benign Het
Thbs3 T A 3: 89,217,976 probably benign Het
Top3a A T 11: 60,762,539 N56K possibly damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Tyk2 T C 9: 21,109,381 D918G probably damaging Het
Uqcrh A G 4: 116,067,284 probably benign Het
Vmn1r61 A G 7: 5,610,815 S167P probably damaging Het
Wdr25 C A 12: 109,026,440 H74N probably damaging Het
Zfp458 T C 13: 67,256,318 N686D probably benign Het
Zfp574 T A 7: 25,081,090 H512Q probably damaging Het
Zfp976 A T 7: 42,613,478 Y312N probably benign Het
Zscan4c G A 7: 11,009,535 V354I probably benign Het
Other mutations in Actb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Actb APN 5 142904436 missense probably damaging 0.97
R1612:Actb UTSW 5 142905595 missense probably damaging 1.00
R4872:Actb UTSW 5 142905552 splice site probably benign
R5424:Actb UTSW 5 142905551 splice site probably benign
R7329:Actb UTSW 5 142904391 missense probably benign 0.00
R7748:Actb UTSW 5 142904695 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTTGCTCTGACAACCACAGG -3'
(R):5'- CCAGGTCATCACTATTGGCAACG -3'

Sequencing Primer
(F):5'- TCACCAAGCTAAGGATGCTTAG -3'
(R):5'- AACGAGCGGTTCCGATG -3'
Posted On2016-07-22