Incidental Mutation 'R5305:Tyk2'
ID404507
Institutional Source Beutler Lab
Gene Symbol Tyk2
Ensembl Gene ENSMUSG00000032175
Gene Nametyrosine kinase 2
SynonymsJTK1
MMRRC Submission 042888-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5305 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location21104068-21131243 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21109381 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 918 (D918G)
Ref Sequence ENSEMBL: ENSMUSP00000150214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001036] [ENSMUST00000214454] [ENSMUST00000216874]
Predicted Effect probably damaging
Transcript: ENSMUST00000001036
AA Change: D941G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000001036
Gene: ENSMUSG00000032175
AA Change: D941G

DomainStartEndE-ValueType
B41 29 301 1.51e-26 SMART
Blast:B41 408 460 3e-12 BLAST
SH2 470 562 1.26e-2 SMART
STYKc 612 886 8.89e-15 SMART
TyrKc 917 1189 6.48e-114 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213717
Predicted Effect probably damaging
Transcript: ENSMUST00000214454
AA Change: D918G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000216874
AA Change: D941G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Meta Mutation Damage Score 0.4036 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tyrosine kinase and, more specifically, the Janus kinases (JAKs) protein families. This protein associates with the cytoplasmic domain of type I and type II cytokine receptors and promulgate cytokine signals by phosphorylating receptor subunits. It is also component of both the type I and type III interferon signaling pathways. As such, it may play a role in anti-viral immunity. A mutation in this gene has been associated with hyperimmunoglobulin E syndrome (HIES) - a primary immunodeficiency characterized by elevated serum immunoglobulin E. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are viable and fertile, but differ from wild-type with respect to interleukin 12 mediated T cell function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G A 15: 82,059,219 V11M possibly damaging Het
Acot8 A G 2: 164,795,765 V179A probably benign Het
Actb A G 5: 142,904,230 I194T probably benign Het
Ap1g2 A G 14: 55,099,076 V787A probably benign Het
Areg G T 5: 91,144,449 A203S probably damaging Het
Asb13 A T 13: 3,643,479 D79V probably damaging Het
Atad2b C T 12: 4,965,855 T527I probably damaging Het
Auts2 T G 5: 131,443,794 probably benign Het
Ceacam3 T A 7: 17,151,576 S35T probably damaging Het
Crebzf T C 7: 90,444,134 probably benign Het
Cttnbp2 G T 6: 18,381,098 N1366K probably benign Het
Cubn C A 2: 13,388,939 C1417F probably damaging Het
Dot1l C T 10: 80,790,793 P162S probably benign Het
Epc1 G A 18: 6,490,690 probably benign Het
Eps8l1 A G 7: 4,477,896 S613G possibly damaging Het
Erich6 T G 3: 58,625,116 I357L probably benign Het
Foxj3 T A 4: 119,619,958 S288T possibly damaging Het
Gls2 T G 10: 128,204,709 Y326* probably null Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm7535 T C 17: 17,911,799 probably benign Het
Gxylt2 T G 6: 100,787,218 L288R probably damaging Het
Kdm4a T C 4: 118,160,501 Y456C probably damaging Het
Mgat4c T A 10: 102,389,279 F451L possibly damaging Het
Mrpl20 G A 4: 155,803,705 R17H probably damaging Het
Mtf2 A G 5: 108,104,499 T465A possibly damaging Het
Mycbp2 A C 14: 103,346,321 L66R probably benign Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Nr2e1 A T 10: 42,571,487 Y176* probably null Het
Obscn T C 11: 59,012,715 T7628A possibly damaging Het
Olfr1353 A T 10: 78,970,556 K302N possibly damaging Het
Pitx2 T G 3: 129,215,840 V129G probably damaging Het
Polr2e A G 10: 80,038,063 probably benign Het
Ppard A G 17: 28,298,858 D300G probably damaging Het
Ppp1r27 A G 11: 120,550,917 V46A probably benign Het
Prex2 T A 1: 11,107,678 V332E probably damaging Het
Prss30 T G 17: 23,972,776 Y257S probably benign Het
Ptprd T C 4: 75,982,626 E1082G probably damaging Het
Rab3c T A 13: 110,181,077 R89S probably damaging Het
Rimbp2 A G 5: 128,797,381 V389A possibly damaging Het
Rims1 T A 1: 22,596,542 R119S probably damaging Het
Sema3b T C 9: 107,603,337 H137R probably null Het
Sf3b4 G C 3: 96,173,642 A89P probably damaging Het
Sgta T A 10: 81,046,247 Q298L probably damaging Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Sry T A Y: 2,662,982 D226V unknown Het
Sv2a A G 3: 96,185,458 E158G possibly damaging Het
Sytl2 A G 7: 90,381,863 probably benign Het
Thbs3 T A 3: 89,217,976 probably benign Het
Top3a A T 11: 60,762,539 N56K possibly damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Uqcrh A G 4: 116,067,284 probably benign Het
Vmn1r61 A G 7: 5,610,815 S167P probably damaging Het
Wdr25 C A 12: 109,026,440 H74N probably damaging Het
Zfp458 T C 13: 67,256,318 N686D probably benign Het
Zfp574 T A 7: 25,081,090 H512Q probably damaging Het
Zfp976 A T 7: 42,613,478 Y312N probably benign Het
Zscan4c G A 7: 11,009,535 V354I probably benign Het
Other mutations in Tyk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Tyk2 APN 9 21120588 missense probably benign 0.27
IGL01015:Tyk2 APN 9 21120700 missense probably benign 0.00
IGL01096:Tyk2 APN 9 21108863 missense probably damaging 1.00
IGL01410:Tyk2 APN 9 21109364 missense probably damaging 1.00
IGL01613:Tyk2 APN 9 21120576 missense probably damaging 0.99
IGL01997:Tyk2 APN 9 21110494 missense probably damaging 1.00
IGL02249:Tyk2 APN 9 21120407 missense probably damaging 1.00
IGL02407:Tyk2 APN 9 21109227 splice site probably benign
IGL02538:Tyk2 APN 9 21111043 missense possibly damaging 0.94
IGL03185:Tyk2 APN 9 21109384 missense probably damaging 1.00
ANU74:Tyk2 UTSW 9 21116158 missense probably damaging 1.00
R0355:Tyk2 UTSW 9 21114190 splice site probably null
R0667:Tyk2 UTSW 9 21108871 missense probably damaging 1.00
R0862:Tyk2 UTSW 9 21116167 missense probably benign 0.00
R0883:Tyk2 UTSW 9 21111137 missense possibly damaging 0.61
R1554:Tyk2 UTSW 9 21107922 missense probably damaging 0.96
R1575:Tyk2 UTSW 9 21115462 missense probably benign 0.00
R1664:Tyk2 UTSW 9 21120353 missense probably damaging 1.00
R1676:Tyk2 UTSW 9 21115249 nonsense probably null
R1843:Tyk2 UTSW 9 21121554 nonsense probably null
R1871:Tyk2 UTSW 9 21121441 missense probably damaging 1.00
R2044:Tyk2 UTSW 9 21120341 missense probably damaging 1.00
R2137:Tyk2 UTSW 9 21110985 intron probably benign
R2197:Tyk2 UTSW 9 21115207 missense probably damaging 1.00
R2883:Tyk2 UTSW 9 21110587 missense probably benign 0.01
R2941:Tyk2 UTSW 9 21111119 missense probably benign 0.00
R3001:Tyk2 UTSW 9 21109321 missense probably benign 0.00
R3002:Tyk2 UTSW 9 21109321 missense probably benign 0.00
R3196:Tyk2 UTSW 9 21124032 missense possibly damaging 0.80
R3622:Tyk2 UTSW 9 21127310 missense probably damaging 0.98
R4024:Tyk2 UTSW 9 21115919 missense probably damaging 1.00
R4459:Tyk2 UTSW 9 21124415 missense probably damaging 1.00
R4604:Tyk2 UTSW 9 21108009 missense probably damaging 1.00
R4664:Tyk2 UTSW 9 21114207 missense probably damaging 0.99
R4666:Tyk2 UTSW 9 21114207 missense probably damaging 0.99
R4915:Tyk2 UTSW 9 21111137 missense probably benign 0.41
R4971:Tyk2 UTSW 9 21120501 critical splice donor site probably null
R5014:Tyk2 UTSW 9 21115830 splice site probably null
R5191:Tyk2 UTSW 9 21107497 missense probably damaging 0.98
R5356:Tyk2 UTSW 9 21115744 missense probably benign 0.03
R5501:Tyk2 UTSW 9 21121612 missense probably damaging 1.00
R6025:Tyk2 UTSW 9 21115960 missense probably benign 0.05
R6113:Tyk2 UTSW 9 21107922 missense probably damaging 1.00
R6159:Tyk2 UTSW 9 21110504 missense probably damaging 0.99
R6608:Tyk2 UTSW 9 21108016 missense probably benign 0.02
R6610:Tyk2 UTSW 9 21108016 missense probably benign 0.02
R6612:Tyk2 UTSW 9 21108016 missense probably benign 0.02
R6870:Tyk2 UTSW 9 21124954 missense probably damaging 1.00
R7216:Tyk2 UTSW 9 21120526 missense probably benign 0.01
R7218:Tyk2 UTSW 9 21105054 missense probably damaging 1.00
R7298:Tyk2 UTSW 9 21108860 missense probably benign 0.35
R7322:Tyk2 UTSW 9 21110204 missense probably benign
R7347:Tyk2 UTSW 9 21108034 missense probably damaging 0.99
R7759:Tyk2 UTSW 9 21120258 critical splice donor site probably null
R7840:Tyk2 UTSW 9 21124967 missense probably damaging 1.00
R7854:Tyk2 UTSW 9 21115480 missense probably benign
R7923:Tyk2 UTSW 9 21124967 missense probably damaging 1.00
R7937:Tyk2 UTSW 9 21115480 missense probably benign
Z1177:Tyk2 UTSW 9 21105367 missense probably benign
Z1177:Tyk2 UTSW 9 21108875 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGAGGGAACAGCCATAC -3'
(R):5'- GCTGGTTTGGAGAACTGCAG -3'

Sequencing Primer
(F):5'- TACCCACACACCATGGCAGG -3'
(R):5'- GGTGGCTCACAACCATCTGTAATG -3'
Posted On2016-07-22