Incidental Mutation 'R5305:Olfr1353'
ID404509
Institutional Source Beutler Lab
Gene Symbol Olfr1353
Ensembl Gene ENSMUSG00000042774
Gene Nameolfactory receptor 1353
SynonymsGA_x6K02T2QGN0-2842591-2841662, MOR139-2
MMRRC Submission 042888-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R5305 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location78963309-78971338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78970556 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 302 (K302N)
Ref Sequence ENSEMBL: ENSMUSP00000145073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039718] [ENSMUST00000204849] [ENSMUST00000205193]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039718
AA Change: K302N

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000038992
Gene: ENSMUSG00000042774
AA Change: K302N

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.2e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.9e-6 PFAM
Pfam:7tm_1 41 290 9.3e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204849
AA Change: K302N

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000145454
Gene: ENSMUSG00000042774
AA Change: K302N

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.2e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.9e-6 PFAM
Pfam:7tm_1 41 290 9.3e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000205193
AA Change: K302N

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000145073
Gene: ENSMUSG00000042774
AA Change: K302N

DomainStartEndE-ValueType
Pfam:7tm_4 31 95 5.8e-10 PFAM
Pfam:7tm_1 41 94 3.5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219714
Meta Mutation Damage Score 0.2301 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G A 15: 82,059,219 V11M possibly damaging Het
Acot8 A G 2: 164,795,765 V179A probably benign Het
Actb A G 5: 142,904,230 I194T probably benign Het
Ap1g2 A G 14: 55,099,076 V787A probably benign Het
Areg G T 5: 91,144,449 A203S probably damaging Het
Asb13 A T 13: 3,643,479 D79V probably damaging Het
Atad2b C T 12: 4,965,855 T527I probably damaging Het
Auts2 T G 5: 131,443,794 probably benign Het
Ceacam3 T A 7: 17,151,576 S35T probably damaging Het
Crebzf T C 7: 90,444,134 probably benign Het
Cttnbp2 G T 6: 18,381,098 N1366K probably benign Het
Cubn C A 2: 13,388,939 C1417F probably damaging Het
Dot1l C T 10: 80,790,793 P162S probably benign Het
Epc1 G A 18: 6,490,690 probably benign Het
Eps8l1 A G 7: 4,477,896 S613G possibly damaging Het
Erich6 T G 3: 58,625,116 I357L probably benign Het
Foxj3 T A 4: 119,619,958 S288T possibly damaging Het
Gls2 T G 10: 128,204,709 Y326* probably null Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm7535 T C 17: 17,911,799 probably benign Het
Gxylt2 T G 6: 100,787,218 L288R probably damaging Het
Kdm4a T C 4: 118,160,501 Y456C probably damaging Het
Mgat4c T A 10: 102,389,279 F451L possibly damaging Het
Mrpl20 G A 4: 155,803,705 R17H probably damaging Het
Mtf2 A G 5: 108,104,499 T465A possibly damaging Het
Mycbp2 A C 14: 103,346,321 L66R probably benign Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Nr2e1 A T 10: 42,571,487 Y176* probably null Het
Obscn T C 11: 59,012,715 T7628A possibly damaging Het
Pitx2 T G 3: 129,215,840 V129G probably damaging Het
Polr2e A G 10: 80,038,063 probably benign Het
Ppard A G 17: 28,298,858 D300G probably damaging Het
Ppp1r27 A G 11: 120,550,917 V46A probably benign Het
Prex2 T A 1: 11,107,678 V332E probably damaging Het
Prss30 T G 17: 23,972,776 Y257S probably benign Het
Ptprd T C 4: 75,982,626 E1082G probably damaging Het
Rab3c T A 13: 110,181,077 R89S probably damaging Het
Rimbp2 A G 5: 128,797,381 V389A possibly damaging Het
Rims1 T A 1: 22,596,542 R119S probably damaging Het
Sema3b T C 9: 107,603,337 H137R probably null Het
Sf3b4 G C 3: 96,173,642 A89P probably damaging Het
Sgta T A 10: 81,046,247 Q298L probably damaging Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Sry T A Y: 2,662,982 D226V unknown Het
Sv2a A G 3: 96,185,458 E158G possibly damaging Het
Sytl2 A G 7: 90,381,863 probably benign Het
Thbs3 T A 3: 89,217,976 probably benign Het
Top3a A T 11: 60,762,539 N56K possibly damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Tyk2 T C 9: 21,109,381 D918G probably damaging Het
Uqcrh A G 4: 116,067,284 probably benign Het
Vmn1r61 A G 7: 5,610,815 S167P probably damaging Het
Wdr25 C A 12: 109,026,440 H74N probably damaging Het
Zfp458 T C 13: 67,256,318 N686D probably benign Het
Zfp574 T A 7: 25,081,090 H512Q probably damaging Het
Zfp976 A T 7: 42,613,478 Y312N probably benign Het
Zscan4c G A 7: 11,009,535 V354I probably benign Het
Other mutations in Olfr1353
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02135:Olfr1353 APN 10 78970106 missense probably damaging 1.00
IGL02159:Olfr1353 APN 10 78969901 missense probably damaging 1.00
R0355:Olfr1353 UTSW 10 78970433 missense probably damaging 1.00
R0561:Olfr1353 UTSW 10 78969895 nonsense probably null
R1305:Olfr1353 UTSW 10 78970099 missense probably benign 0.03
R1921:Olfr1353 UTSW 10 78970141 nonsense probably null
R1922:Olfr1353 UTSW 10 78970141 nonsense probably null
R2382:Olfr1353 UTSW 10 78970156 missense probably damaging 0.99
R2920:Olfr1353 UTSW 10 78970012 missense probably damaging 1.00
R4491:Olfr1353 UTSW 10 78970317 missense probably damaging 1.00
R5113:Olfr1353 UTSW 10 78970203 missense probably benign
R5744:Olfr1353 UTSW 10 78970183 missense probably damaging 1.00
R5861:Olfr1353 UTSW 10 78969931 missense probably damaging 1.00
R6197:Olfr1353 UTSW 10 78970140 missense probably damaging 1.00
R6314:Olfr1353 UTSW 10 78970345 missense probably benign
R7693:Olfr1353 UTSW 10 78970303 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAAGCATTCTCCACCTGTG -3'
(R):5'- CTGACTAGTGTTCCAGGCTC -3'

Sequencing Primer
(F):5'- ACCTGTGCATCTCATCTATTAGTTG -3'
(R):5'- ACTAGTGTTCCAGGCTCTAGGAGTC -3'
Posted On2016-07-22