Incidental Mutation 'R5305:Gm11595'
ID 404519
Institutional Source Beutler Lab
Gene Symbol Gm11595
Ensembl Gene ENSMUSG00000078668
Gene Name predicted gene 11595
Synonyms
MMRRC Submission 042888-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # R5305 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 99662540-99663739 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 99663381 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 100 (R100C)
Ref Sequence ENSEMBL: ENSMUSP00000103064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107440]
AlphaFold B1AQA7
Predicted Effect unknown
Transcript: ENSMUST00000107440
AA Change: R100C
SMART Domains Protein: ENSMUSP00000103064
Gene: ENSMUSG00000078668
AA Change: R100C

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 1 47 7.5e-9 PFAM
Pfam:Keratin_B2_2 14 58 2.8e-13 PFAM
Pfam:Keratin_B2_2 29 73 1.2e-13 PFAM
Pfam:Keratin_B2_2 72 112 2.3e-12 PFAM
Pfam:Keratin_B2_2 107 152 4.6e-14 PFAM
Pfam:Keratin_B2_2 118 162 1.1e-13 PFAM
Pfam:Keratin_B2_2 143 187 3.5e-10 PFAM
Pfam:Keratin_B2_2 168 212 5.6e-13 PFAM
Pfam:Keratin_B2_2 178 222 2.4e-12 PFAM
Pfam:Keratin_B2_2 208 257 1.6e-11 PFAM
Pfam:Keratin_B2_2 223 267 4e-14 PFAM
Pfam:Keratin_B2_2 248 289 9e-9 PFAM
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G A 15: 81,943,420 (GRCm39) V11M possibly damaging Het
Acot8 A G 2: 164,637,685 (GRCm39) V179A probably benign Het
Actb A G 5: 142,889,985 (GRCm39) I194T probably benign Het
Ap1g2 A G 14: 55,336,533 (GRCm39) V787A probably benign Het
Areg G T 5: 91,292,308 (GRCm39) A203S probably damaging Het
Asb13 A T 13: 3,693,479 (GRCm39) D79V probably damaging Het
Atad2b C T 12: 5,015,855 (GRCm39) T527I probably damaging Het
Auts2 T G 5: 131,472,632 (GRCm39) probably benign Het
Ceacam3 T A 7: 16,885,501 (GRCm39) S35T probably damaging Het
Crebzf T C 7: 90,093,342 (GRCm39) probably benign Het
Cttnbp2 G T 6: 18,381,097 (GRCm39) N1366K probably benign Het
Cubn C A 2: 13,393,750 (GRCm39) C1417F probably damaging Het
Dot1l C T 10: 80,626,627 (GRCm39) P162S probably benign Het
Epc1 G A 18: 6,490,690 (GRCm39) probably benign Het
Eps8l1 A G 7: 4,480,895 (GRCm39) S613G possibly damaging Het
Erich6 T G 3: 58,532,537 (GRCm39) I357L probably benign Het
Foxj3 T A 4: 119,477,155 (GRCm39) S288T possibly damaging Het
Gls2 T G 10: 128,040,578 (GRCm39) Y326* probably null Het
Gm7535 T C 17: 18,132,061 (GRCm39) probably benign Het
Gxylt2 T G 6: 100,764,179 (GRCm39) L288R probably damaging Het
Kdm4a T C 4: 118,017,698 (GRCm39) Y456C probably damaging Het
Mgat4c T A 10: 102,225,140 (GRCm39) F451L possibly damaging Het
Mrpl20 G A 4: 155,888,162 (GRCm39) R17H probably damaging Het
Mtf2 A G 5: 108,252,365 (GRCm39) T465A possibly damaging Het
Mycbp2 A C 14: 103,583,757 (GRCm39) L66R probably benign Het
Nos1ap T A 1: 170,176,968 (GRCm39) K145M probably damaging Het
Nr2e1 A T 10: 42,447,483 (GRCm39) Y176* probably null Het
Obscn T C 11: 58,903,541 (GRCm39) T7628A possibly damaging Het
Or7a37 A T 10: 78,806,390 (GRCm39) K302N possibly damaging Het
Pitx2 T G 3: 129,009,489 (GRCm39) V129G probably damaging Het
Polr2e A G 10: 79,873,897 (GRCm39) probably benign Het
Ppard A G 17: 28,517,832 (GRCm39) D300G probably damaging Het
Ppp1r27 A G 11: 120,441,743 (GRCm39) V46A probably benign Het
Prex2 T A 1: 11,177,902 (GRCm39) V332E probably damaging Het
Prss30 T G 17: 24,191,750 (GRCm39) Y257S probably benign Het
Ptprd T C 4: 75,900,863 (GRCm39) E1082G probably damaging Het
Rab3c T A 13: 110,317,611 (GRCm39) R89S probably damaging Het
Rimbp2 A G 5: 128,874,445 (GRCm39) V389A possibly damaging Het
Rims1 T A 1: 22,635,623 (GRCm39) R119S probably damaging Het
Sema3b T C 9: 107,480,536 (GRCm39) H137R probably null Het
Sf3b4 G C 3: 96,080,958 (GRCm39) A89P probably damaging Het
Sgta T A 10: 80,882,081 (GRCm39) Q298L probably damaging Het
Skic3 G A 13: 76,295,886 (GRCm39) E1050K possibly damaging Het
Spag9 C A 11: 93,959,838 (GRCm39) D342E probably damaging Het
Sry T A Y: 2,662,982 (GRCm39) D226V unknown Het
Sv2a A G 3: 96,092,774 (GRCm39) E158G possibly damaging Het
Sytl2 A G 7: 90,031,071 (GRCm39) probably benign Het
Thbs3 T A 3: 89,125,283 (GRCm39) probably benign Het
Top3a A T 11: 60,653,365 (GRCm39) N56K possibly damaging Het
Tyk2 T C 9: 21,020,677 (GRCm39) D918G probably damaging Het
Uqcrh A G 4: 115,924,481 (GRCm39) probably benign Het
Vmn1r61 A G 7: 5,613,814 (GRCm39) S167P probably damaging Het
Wdr25 C A 12: 108,992,366 (GRCm39) H74N probably damaging Het
Zfp458 T C 13: 67,404,382 (GRCm39) N686D probably benign Het
Zfp574 T A 7: 24,780,515 (GRCm39) H512Q Het
Zfp976 A T 7: 42,262,902 (GRCm39) Y312N probably benign Het
Zscan4c G A 7: 10,743,462 (GRCm39) V354I probably benign Het
Other mutations in Gm11595
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Gm11595 APN 11 99,662,868 (GRCm39) missense unknown
IGL00987:Gm11595 APN 11 99,663,365 (GRCm39) missense unknown
IGL01662:Gm11595 APN 11 99,663,498 (GRCm39) missense unknown
IGL01994:Gm11595 APN 11 99,663,027 (GRCm39) missense unknown
R0548:Gm11595 UTSW 11 99,662,967 (GRCm39) missense unknown
R1923:Gm11595 UTSW 11 99,663,365 (GRCm39) missense unknown
R2127:Gm11595 UTSW 11 99,663,327 (GRCm39) missense unknown
R2128:Gm11595 UTSW 11 99,663,327 (GRCm39) missense unknown
R3807:Gm11595 UTSW 11 99,663,380 (GRCm39) missense unknown
R4007:Gm11595 UTSW 11 99,662,861 (GRCm39) missense unknown
R5281:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R5283:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R5303:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R5306:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R5307:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R5308:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R5561:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R5637:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R5639:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R5718:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R5719:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R5720:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R5721:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R5769:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R5770:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R5771:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R5791:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R5841:Gm11595 UTSW 11 99,663,143 (GRCm39) missense unknown
R6054:Gm11595 UTSW 11 99,663,474 (GRCm39) missense unknown
R6277:Gm11595 UTSW 11 99,663,510 (GRCm39) missense unknown
R6281:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R6282:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R6310:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R6321:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R6322:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R6327:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R6337:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R6368:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R6369:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R6431:Gm11595 UTSW 11 99,663,600 (GRCm39) missense unknown
R6483:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R6485:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R6493:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R6758:Gm11595 UTSW 11 99,663,367 (GRCm39) nonsense probably null
R6758:Gm11595 UTSW 11 99,663,366 (GRCm39) missense unknown
R7037:Gm11595 UTSW 11 99,663,474 (GRCm39) missense unknown
R8053:Gm11595 UTSW 11 99,662,954 (GRCm39) missense unknown
R8911:Gm11595 UTSW 11 99,663,564 (GRCm39) missense unknown
R9632:Gm11595 UTSW 11 99,663,097 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGAACTACCACAGCAGGGG -3'
(R):5'- ACCATGGTCAGTTCCTGTTG -3'

Sequencing Primer
(F):5'- CGACAGCAGCTGGAGATG -3'
(R):5'- TGCCAGACCACCTGCTGTAG -3'
Posted On 2016-07-22