Incidental Mutation 'R0009:Myef2'
ID40453
Institutional Source Beutler Lab
Gene Symbol Myef2
Ensembl Gene ENSMUSG00000027201
Gene Namemyelin basic protein expression factor 2, repressor
Synonyms
MMRRC Submission 038304-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R0009 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location125084628-125123661 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 125108978 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 312 (D312E)
Ref Sequence ENSEMBL: ENSMUSP00000114817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067780] [ENSMUST00000110501] [ENSMUST00000142718] [ENSMUST00000147105] [ENSMUST00000152367]
Predicted Effect probably benign
Transcript: ENSMUST00000067780
AA Change: D312E

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000066312
Gene: ENSMUSG00000027201
AA Change: D312E

DomainStartEndE-ValueType
RRM 92 165 1.84e-22 SMART
low complexity region 198 211 N/A INTRINSIC
RRM 225 297 5.12e-21 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 430 450 N/A INTRINSIC
RRM 498 569 6.15e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083917
Predicted Effect unknown
Transcript: ENSMUST00000089825
AA Change: D267E
SMART Domains Protein: ENSMUSP00000087258
Gene: ENSMUSG00000027201
AA Change: D267E

DomainStartEndE-ValueType
RRM 48 121 1.84e-22 SMART
low complexity region 154 167 N/A INTRINSIC
RRM 181 253 5.12e-21 SMART
low complexity region 274 291 N/A INTRINSIC
low complexity region 386 406 N/A INTRINSIC
RRM 454 525 6.15e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110501
AA Change: D312E

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000106127
Gene: ENSMUSG00000027201
AA Change: D312E

DomainStartEndE-ValueType
RRM 92 165 1.84e-22 SMART
low complexity region 198 211 N/A INTRINSIC
RRM 225 297 5.12e-21 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 430 450 N/A INTRINSIC
RRM 498 569 6.15e-24 SMART
Predicted Effect unknown
Transcript: ENSMUST00000137091
AA Change: D277E
SMART Domains Protein: ENSMUSP00000123222
Gene: ENSMUSG00000027201
AA Change: D277E

DomainStartEndE-ValueType
RRM 58 131 1.84e-22 SMART
low complexity region 164 177 N/A INTRINSIC
RRM 191 263 5.12e-21 SMART
low complexity region 284 301 N/A INTRINSIC
low complexity region 317 342 N/A INTRINSIC
low complexity region 348 376 N/A INTRINSIC
internal_repeat_2 412 441 4.02e-9 PROSPERO
internal_repeat_3 419 444 2.53e-8 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000142718
AA Change: D312E

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000115519
Gene: ENSMUSG00000027201
AA Change: D312E

DomainStartEndE-ValueType
RRM 92 165 1.84e-22 SMART
low complexity region 198 211 N/A INTRINSIC
RRM 225 297 5.12e-21 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 351 376 N/A INTRINSIC
low complexity region 427 443 N/A INTRINSIC
RRM 491 562 6.15e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147105
AA Change: D312E

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000114817
Gene: ENSMUSG00000027201
AA Change: D312E

DomainStartEndE-ValueType
RRM 92 165 1.84e-22 SMART
low complexity region 198 211 N/A INTRINSIC
RRM 225 297 5.12e-21 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 410 426 N/A INTRINSIC
RRM 474 545 6.15e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149911
Predicted Effect probably benign
Transcript: ENSMUST00000152367
AA Change: D312E

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000123088
Gene: ENSMUSG00000027201
AA Change: D312E

DomainStartEndE-ValueType
RRM 92 165 1.84e-22 SMART
low complexity region 198 211 N/A INTRINSIC
RRM 225 297 5.12e-21 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 351 376 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
RRM 515 586 6.15e-24 SMART
Meta Mutation Damage Score 0.0576 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (68/68)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T G 15: 60,919,633 probably benign Het
Abcg4 T G 9: 44,277,649 probably benign Het
Afm C A 5: 90,545,384 probably benign Het
Ahrr G A 13: 74,283,024 probably benign Het
Aplnr T A 2: 85,137,276 probably null Het
Arih2 T A 9: 108,611,727 H264L probably damaging Het
Atp1a1 A T 3: 101,579,835 I886N possibly damaging Het
Bmf A T 2: 118,549,622 V14E probably damaging Het
Ccdc116 T C 16: 17,144,039 E15G probably damaging Het
Ccdc175 T C 12: 72,135,965 N427D possibly damaging Het
Cfap53 A G 18: 74,299,176 H45R probably benign Het
Chd3 A G 11: 69,349,906 L1569P probably damaging Het
Cntn2 G A 1: 132,516,180 Q457* probably null Het
Coro1a A T 7: 126,701,413 probably benign Het
Cracr2b T A 7: 141,463,759 L91Q probably damaging Het
Ctdspl T C 9: 119,020,046 probably null Het
Dip2b T A 15: 100,169,312 L565Q probably damaging Het
Dip2c T A 13: 9,621,903 C1004S probably damaging Het
Dnah11 A T 12: 118,045,522 I2135N possibly damaging Het
Dnah14 A G 1: 181,769,407 probably benign Het
Dnase1 T C 16: 4,038,946 V147A probably damaging Het
Dusp8 T C 7: 142,082,054 probably benign Het
Fer1l6 T C 15: 58,662,787 Y1828H probably damaging Het
Flvcr1 A G 1: 191,008,191 V544A probably benign Het
Fsd1l T C 4: 53,687,209 V311A probably benign Het
Glud1 G A 14: 34,334,268 G300S probably benign Het
Gm4847 C T 1: 166,630,486 V433I probably benign Het
Gstm3 T G 3: 107,967,840 Y62S probably damaging Het
Gtse1 C T 15: 85,862,435 P151S probably benign Het
Herc2 T C 7: 56,207,812 S4048P probably benign Het
Hp1bp3 T A 4: 138,221,683 I19K probably benign Het
Htr7 C A 19: 36,041,540 probably benign Het
Il1a C T 2: 129,309,074 D10N probably damaging Het
Il22ra2 A T 10: 19,624,458 N39I probably damaging Het
Kcnn4 T C 7: 24,379,255 C267R possibly damaging Het
Larp1 A G 11: 58,055,473 K879R possibly damaging Het
Lcn5 T A 2: 25,661,405 probably benign Het
Lep T A 6: 29,068,972 C7* probably null Het
Magi2 A T 5: 20,611,055 Y747F probably benign Het
Mast4 T C 13: 102,742,058 T1223A probably damaging Het
Mcc C T 18: 44,445,933 E803K probably damaging Het
Mtmr4 T C 11: 87,611,508 I796T probably benign Het
Myl3 A C 9: 110,767,929 D119A probably damaging Het
Myo19 T A 11: 84,888,169 probably null Het
Naa15 T G 3: 51,470,219 H763Q probably damaging Het
Pde5a C T 3: 122,824,902 probably benign Het
Plpp2 C T 10: 79,527,244 R184H probably benign Het
Rab19 T G 6: 39,389,687 L179V probably damaging Het
Rims2 T A 15: 39,534,966 M1087K probably damaging Het
Riox2 C A 16: 59,489,367 D361E probably benign Het
Sh3rf1 T A 8: 61,226,293 V123E probably damaging Het
Slc35e1 A T 8: 72,484,709 N318K probably damaging Het
Slc9a2 A T 1: 40,763,602 E604V probably benign Het
Srp72 T C 5: 76,987,885 S221P probably damaging Het
Tbx19 A T 1: 165,160,520 S15T possibly damaging Het
Tcea2 A G 2: 181,685,817 T112A probably benign Het
Tesk1 T A 4: 43,445,368 D230E probably damaging Het
Tm4sf5 C T 11: 70,510,712 A179V probably damaging Het
Tnr G T 1: 159,852,416 G320V probably damaging Het
Trappc11 A T 8: 47,503,320 C874S possibly damaging Het
Trpm3 T A 19: 22,914,446 Y885N probably damaging Het
Unc5a T A 13: 55,002,879 C505S probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Xpo5 T C 17: 46,204,786 probably benign Het
Zfp637 C A 6: 117,845,668 H252Q probably damaging Het
Zfp646 T A 7: 127,880,731 D693E probably damaging Het
Other mutations in Myef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Myef2 APN 2 125115475 missense probably damaging 1.00
IGL01116:Myef2 APN 2 125098482 missense probably damaging 0.99
IGL02197:Myef2 APN 2 125114039 splice site probably null
IGL02525:Myef2 APN 2 125114058 splice site probably benign
IGL02554:Myef2 APN 2 125100425 splice site probably null
IGL03027:Myef2 APN 2 125089034 missense possibly damaging 0.89
R0510:Myef2 UTSW 2 125109034 splice site probably benign
R0583:Myef2 UTSW 2 125097981 synonymous probably null
R1112:Myef2 UTSW 2 125097586 missense probably damaging 1.00
R1656:Myef2 UTSW 2 125097940 intron probably null
R1682:Myef2 UTSW 2 125098058 missense probably damaging 0.97
R1769:Myef2 UTSW 2 125115443 missense probably damaging 1.00
R1983:Myef2 UTSW 2 125098845 missense probably benign 0.00
R2175:Myef2 UTSW 2 125098455 missense probably damaging 0.99
R4261:Myef2 UTSW 2 125115479 missense possibly damaging 0.77
R4643:Myef2 UTSW 2 125116811 missense possibly damaging 0.78
R4712:Myef2 UTSW 2 125088837 intron probably benign
R4914:Myef2 UTSW 2 125109739 nonsense probably null
R5276:Myef2 UTSW 2 125095721 missense probably damaging 1.00
R5507:Myef2 UTSW 2 125116703 missense probably benign 0.17
R5930:Myef2 UTSW 2 125095731 nonsense probably null
R6335:Myef2 UTSW 2 125109712 missense probably damaging 1.00
R6502:Myef2 UTSW 2 125116682 missense probably damaging 1.00
R7201:Myef2 UTSW 2 125096162 intron probably null
R7421:Myef2 UTSW 2 125110617 missense probably benign 0.03
R7619:Myef2 UTSW 2 125123476 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAGAAGTGGCACACTGTCCAAAAC -3'
(R):5'- GGCTTTTGCCTACAGCAGGAAACC -3'

Sequencing Primer
(F):5'- CCCCAAACTAATCTCAGAGAGTG -3'
(R):5'- CCTAACATAATAGCTCTTGTTAGCTG -3'
Posted On2013-05-23