Incidental Mutation 'R5305:Gm7535'
ID 404531
Institutional Source Beutler Lab
Gene Symbol Gm7535
Ensembl Gene ENSMUSG00000090957
Gene Name predicted gene 7535
Synonyms
MMRRC Submission 042888-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.197) question?
Stock # R5305 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 18131304-18132987 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) T to C at 18132061 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000093316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054871] [ENSMUST00000164167]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000054871
SMART Domains Protein: ENSMUSP00000093316
Gene: ENSMUSG00000079700

DomainStartEndE-ValueType
Pfam:7tm_1 43 302 2.2e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164167
SMART Domains Protein: ENSMUSP00000125897
Gene: ENSMUSG00000090957

DomainStartEndE-ValueType
Pfam:CNDH2_C 15 292 6.7e-90 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231820
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G A 15: 81,943,420 (GRCm39) V11M possibly damaging Het
Acot8 A G 2: 164,637,685 (GRCm39) V179A probably benign Het
Actb A G 5: 142,889,985 (GRCm39) I194T probably benign Het
Ap1g2 A G 14: 55,336,533 (GRCm39) V787A probably benign Het
Areg G T 5: 91,292,308 (GRCm39) A203S probably damaging Het
Asb13 A T 13: 3,693,479 (GRCm39) D79V probably damaging Het
Atad2b C T 12: 5,015,855 (GRCm39) T527I probably damaging Het
Auts2 T G 5: 131,472,632 (GRCm39) probably benign Het
Ceacam3 T A 7: 16,885,501 (GRCm39) S35T probably damaging Het
Crebzf T C 7: 90,093,342 (GRCm39) probably benign Het
Cttnbp2 G T 6: 18,381,097 (GRCm39) N1366K probably benign Het
Cubn C A 2: 13,393,750 (GRCm39) C1417F probably damaging Het
Dot1l C T 10: 80,626,627 (GRCm39) P162S probably benign Het
Epc1 G A 18: 6,490,690 (GRCm39) probably benign Het
Eps8l1 A G 7: 4,480,895 (GRCm39) S613G possibly damaging Het
Erich6 T G 3: 58,532,537 (GRCm39) I357L probably benign Het
Foxj3 T A 4: 119,477,155 (GRCm39) S288T possibly damaging Het
Gls2 T G 10: 128,040,578 (GRCm39) Y326* probably null Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
Gxylt2 T G 6: 100,764,179 (GRCm39) L288R probably damaging Het
Kdm4a T C 4: 118,017,698 (GRCm39) Y456C probably damaging Het
Mgat4c T A 10: 102,225,140 (GRCm39) F451L possibly damaging Het
Mrpl20 G A 4: 155,888,162 (GRCm39) R17H probably damaging Het
Mtf2 A G 5: 108,252,365 (GRCm39) T465A possibly damaging Het
Mycbp2 A C 14: 103,583,757 (GRCm39) L66R probably benign Het
Nos1ap T A 1: 170,176,968 (GRCm39) K145M probably damaging Het
Nr2e1 A T 10: 42,447,483 (GRCm39) Y176* probably null Het
Obscn T C 11: 58,903,541 (GRCm39) T7628A possibly damaging Het
Or7a37 A T 10: 78,806,390 (GRCm39) K302N possibly damaging Het
Pitx2 T G 3: 129,009,489 (GRCm39) V129G probably damaging Het
Polr2e A G 10: 79,873,897 (GRCm39) probably benign Het
Ppard A G 17: 28,517,832 (GRCm39) D300G probably damaging Het
Ppp1r27 A G 11: 120,441,743 (GRCm39) V46A probably benign Het
Prex2 T A 1: 11,177,902 (GRCm39) V332E probably damaging Het
Prss30 T G 17: 24,191,750 (GRCm39) Y257S probably benign Het
Ptprd T C 4: 75,900,863 (GRCm39) E1082G probably damaging Het
Rab3c T A 13: 110,317,611 (GRCm39) R89S probably damaging Het
Rimbp2 A G 5: 128,874,445 (GRCm39) V389A possibly damaging Het
Rims1 T A 1: 22,635,623 (GRCm39) R119S probably damaging Het
Sema3b T C 9: 107,480,536 (GRCm39) H137R probably null Het
Sf3b4 G C 3: 96,080,958 (GRCm39) A89P probably damaging Het
Sgta T A 10: 80,882,081 (GRCm39) Q298L probably damaging Het
Skic3 G A 13: 76,295,886 (GRCm39) E1050K possibly damaging Het
Spag9 C A 11: 93,959,838 (GRCm39) D342E probably damaging Het
Sry T A Y: 2,662,982 (GRCm39) D226V unknown Het
Sv2a A G 3: 96,092,774 (GRCm39) E158G possibly damaging Het
Sytl2 A G 7: 90,031,071 (GRCm39) probably benign Het
Thbs3 T A 3: 89,125,283 (GRCm39) probably benign Het
Top3a A T 11: 60,653,365 (GRCm39) N56K possibly damaging Het
Tyk2 T C 9: 21,020,677 (GRCm39) D918G probably damaging Het
Uqcrh A G 4: 115,924,481 (GRCm39) probably benign Het
Vmn1r61 A G 7: 5,613,814 (GRCm39) S167P probably damaging Het
Wdr25 C A 12: 108,992,366 (GRCm39) H74N probably damaging Het
Zfp458 T C 13: 67,404,382 (GRCm39) N686D probably benign Het
Zfp574 T A 7: 24,780,515 (GRCm39) H512Q Het
Zfp976 A T 7: 42,262,902 (GRCm39) Y312N probably benign Het
Zscan4c G A 7: 10,743,462 (GRCm39) V354I probably benign Het
Other mutations in Gm7535
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Gm7535 APN 17 18,132,150 (GRCm39) intron probably benign
IGL01663:Gm7535 APN 17 18,131,619 (GRCm39) intron probably benign
R0165:Gm7535 UTSW 17 18,131,437 (GRCm39) intron probably benign
R0335:Gm7535 UTSW 17 18,131,374 (GRCm39) intron probably benign
R1985:Gm7535 UTSW 17 18,131,800 (GRCm39) intron probably benign
R2217:Gm7535 UTSW 17 18,131,936 (GRCm39) intron probably benign
R2218:Gm7535 UTSW 17 18,131,936 (GRCm39) intron probably benign
R4464:Gm7535 UTSW 17 18,131,924 (GRCm39) intron probably benign
R4581:Gm7535 UTSW 17 18,131,345 (GRCm39) intron probably benign
R4887:Gm7535 UTSW 17 18,131,333 (GRCm39) intron probably benign
R5225:Gm7535 UTSW 17 18,131,809 (GRCm39) intron probably benign
R5641:Gm7535 UTSW 17 18,131,788 (GRCm39) intron probably benign
R5658:Gm7535 UTSW 17 18,131,582 (GRCm39) intron probably benign
R5760:Gm7535 UTSW 17 18,132,080 (GRCm39) intron probably benign
Predicted Primers PCR Primer
(F):5'- TAGGCCACAGATCCTGCTTG -3'
(R):5'- ATCTTGCCAAGGAGATACATGC -3'

Sequencing Primer
(F):5'- GCCCCAGGTAGCCATCTCTTG -3'
(R):5'- AGATACATGCTAAGGGGCCCC -3'
Posted On 2016-07-22