Incidental Mutation 'R5305:Ppard'
ID404533
Institutional Source Beutler Lab
Gene Symbol Ppard
Ensembl Gene ENSMUSG00000002250
Gene Nameperoxisome proliferator activator receptor delta
SynonymsNr1c2, Pparb/d, PPAR-delta, Peroxisome proliferator-activated receptor beta, Pparb, NUC1, PPARdelta/beta
MMRRC Submission 042888-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.921) question?
Stock #R5305 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location28232754-28301469 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28298858 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 300 (D300G)
Ref Sequence ENSEMBL: ENSMUSP00000002320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002320] [ENSMUST00000169040]
Predicted Effect probably damaging
Transcript: ENSMUST00000002320
AA Change: D300G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002320
Gene: ENSMUSG00000002250
AA Change: D300G

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
ZnF_C4 70 140 1.58e-33 SMART
Blast:HOLI 183 208 1e-6 BLAST
HOLI 250 409 1.36e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166744
Predicted Effect probably benign
Transcript: ENSMUST00000169040
SMART Domains Protein: ENSMUSP00000133077
Gene: ENSMUSG00000002250

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
ZnF_C4 70 140 1.58e-33 SMART
Meta Mutation Damage Score 0.7477 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peroxisome proliferator-activated receptor (PPAR) family. PPARs are nuclear hormone receptors that bind peroxisome proliferators and control the size and number of peroxisomes produced by cells. PPARs mediate a variety of biological processes, and may be involved in the development of several chronic diseases, including diabetes, obesity, atherosclerosis, and cancer. This protein is a potent inhibitor of ligand-induced transcription activity of PPAR alpha and PPAR gamma. It may function as an integrator of transcription repression and nuclear receptor signaling. The expression of this gene is found to be elevated in colorectal cancer cells. The elevated expression can be repressed by adenomatosis polyposis coli (APC), a tumor suppressor protein related to APC/beta-catenin signaling pathway. Knockout studies in mice suggested the role of this protein in myelination of the corpus callosum, lipid metabolism, and epidermal cell proliferation. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a number of different targeted mutations show variable prenatal lethality and a range of phenotypes such as placental, brain, skin, hair follicle, adipose and lipid homeostasis abnormalities, growth retardation, reduced fertility, andincreased incidence of tumors/induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G A 15: 82,059,219 V11M possibly damaging Het
Acot8 A G 2: 164,795,765 V179A probably benign Het
Actb A G 5: 142,904,230 I194T probably benign Het
Ap1g2 A G 14: 55,099,076 V787A probably benign Het
Areg G T 5: 91,144,449 A203S probably damaging Het
Asb13 A T 13: 3,643,479 D79V probably damaging Het
Atad2b C T 12: 4,965,855 T527I probably damaging Het
Auts2 T G 5: 131,443,794 probably benign Het
Ceacam3 T A 7: 17,151,576 S35T probably damaging Het
Crebzf T C 7: 90,444,134 probably benign Het
Cttnbp2 G T 6: 18,381,098 N1366K probably benign Het
Cubn C A 2: 13,388,939 C1417F probably damaging Het
Dot1l C T 10: 80,790,793 P162S probably benign Het
Epc1 G A 18: 6,490,690 probably benign Het
Eps8l1 A G 7: 4,477,896 S613G possibly damaging Het
Erich6 T G 3: 58,625,116 I357L probably benign Het
Foxj3 T A 4: 119,619,958 S288T possibly damaging Het
Gls2 T G 10: 128,204,709 Y326* probably null Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm7535 T C 17: 17,911,799 probably benign Het
Gxylt2 T G 6: 100,787,218 L288R probably damaging Het
Kdm4a T C 4: 118,160,501 Y456C probably damaging Het
Mgat4c T A 10: 102,389,279 F451L possibly damaging Het
Mrpl20 G A 4: 155,803,705 R17H probably damaging Het
Mtf2 A G 5: 108,104,499 T465A possibly damaging Het
Mycbp2 A C 14: 103,346,321 L66R probably benign Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Nr2e1 A T 10: 42,571,487 Y176* probably null Het
Obscn T C 11: 59,012,715 T7628A possibly damaging Het
Olfr1353 A T 10: 78,970,556 K302N possibly damaging Het
Pitx2 T G 3: 129,215,840 V129G probably damaging Het
Polr2e A G 10: 80,038,063 probably benign Het
Ppp1r27 A G 11: 120,550,917 V46A probably benign Het
Prex2 T A 1: 11,107,678 V332E probably damaging Het
Prss30 T G 17: 23,972,776 Y257S probably benign Het
Ptprd T C 4: 75,982,626 E1082G probably damaging Het
Rab3c T A 13: 110,181,077 R89S probably damaging Het
Rimbp2 A G 5: 128,797,381 V389A possibly damaging Het
Rims1 T A 1: 22,596,542 R119S probably damaging Het
Sema3b T C 9: 107,603,337 H137R probably null Het
Sf3b4 G C 3: 96,173,642 A89P probably damaging Het
Sgta T A 10: 81,046,247 Q298L probably damaging Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Sry T A Y: 2,662,982 D226V unknown Het
Sv2a A G 3: 96,185,458 E158G possibly damaging Het
Sytl2 A G 7: 90,381,863 probably benign Het
Thbs3 T A 3: 89,217,976 probably benign Het
Top3a A T 11: 60,762,539 N56K possibly damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Tyk2 T C 9: 21,109,381 D918G probably damaging Het
Uqcrh A G 4: 116,067,284 probably benign Het
Vmn1r61 A G 7: 5,610,815 S167P probably damaging Het
Wdr25 C A 12: 109,026,440 H74N probably damaging Het
Zfp458 T C 13: 67,256,318 N686D probably benign Het
Zfp574 T A 7: 25,081,090 H512Q probably damaging Het
Zfp976 A T 7: 42,613,478 Y312N probably benign Het
Zscan4c G A 7: 11,009,535 V354I probably benign Het
Other mutations in Ppard
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Ppard APN 17 28298903 missense probably damaging 1.00
IGL02023:Ppard APN 17 28298897 missense probably benign
IGL03027:Ppard APN 17 28299791 missense possibly damaging 0.68
R1687:Ppard UTSW 17 28297180 missense probably damaging 1.00
R1785:Ppard UTSW 17 28298481 critical splice donor site probably null
R1791:Ppard UTSW 17 28286374 missense unknown
R1832:Ppard UTSW 17 28297110 missense probably benign 0.01
R2062:Ppard UTSW 17 28299689 missense probably damaging 1.00
R4732:Ppard UTSW 17 28286443 missense probably benign
R4733:Ppard UTSW 17 28286443 missense probably benign
R4801:Ppard UTSW 17 28286374 missense unknown
R4802:Ppard UTSW 17 28286374 missense unknown
R4803:Ppard UTSW 17 28286374 missense unknown
R5252:Ppard UTSW 17 28298848 missense probably benign
R6572:Ppard UTSW 17 28297119 nonsense probably null
R7060:Ppard UTSW 17 28298912 missense probably benign 0.00
R7098:Ppard UTSW 17 28298813 missense possibly damaging 0.94
R7506:Ppard UTSW 17 28298761 missense possibly damaging 0.76
R7599:Ppard UTSW 17 28297117 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTGTGCACGTGTTCTAC -3'
(R):5'- ACACTGTCTGAGGTCAGGTTTG -3'

Sequencing Primer
(F):5'- GTGCACGTGTTCTACCGCTG -3'
(R):5'- CAGGTTTGGTCCCTGGCAG -3'
Posted On2016-07-22