Incidental Mutation 'R5305:Epc1'
ID404534
Institutional Source Beutler Lab
Gene Symbol Epc1
Ensembl Gene ENSMUSG00000024240
Gene Nameenhancer of polycomb homolog 1
Synonyms2400007E14Rik, A930032N02Rik, 5730566F07Rik
MMRRC Submission 042888-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5305 (G1)
Quality Score186
Status Validated
Chromosome18
Chromosomal Location6435951-6516108 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to A at 6490690 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000111536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028100] [ENSMUST00000050542] [ENSMUST00000115870]
Predicted Effect probably benign
Transcript: ENSMUST00000028100
SMART Domains Protein: ENSMUSP00000028100
Gene: ENSMUSG00000024240

DomainStartEndE-ValueType
Pfam:EPL1 7 149 7e-14 PFAM
low complexity region 161 170 N/A INTRINSIC
low complexity region 345 361 N/A INTRINSIC
low complexity region 455 465 N/A INTRINSIC
low complexity region 564 577 N/A INTRINSIC
Pfam:E_Pc_C 581 813 1.6e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050542
SMART Domains Protein: ENSMUSP00000060599
Gene: ENSMUSG00000024240

DomainStartEndE-ValueType
Pfam:EPL1 6 59 7.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115870
SMART Domains Protein: ENSMUSP00000111536
Gene: ENSMUSG00000024240

DomainStartEndE-ValueType
Pfam:EPL1 1 99 1.3e-19 PFAM
low complexity region 111 120 N/A INTRINSIC
low complexity region 295 311 N/A INTRINSIC
low complexity region 405 415 N/A INTRINSIC
low complexity region 514 527 N/A INTRINSIC
Pfam:E_Pc_C 531 763 1.7e-110 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189675
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycomb group (PcG) family. The encoded protein is a component of the NuA4 histone acetyltransferase complex and can act as both a transcriptional activator and repressor. The encoded protein has been linked to apoptosis, DNA repair, skeletal muscle differentiation, gene silencing, and adult T-cell leukemia/lymphoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to P10 (no time point given) and heterozygous mice exhibit impaired skeletal muscle differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G A 15: 82,059,219 V11M possibly damaging Het
Acot8 A G 2: 164,795,765 V179A probably benign Het
Actb A G 5: 142,904,230 I194T probably benign Het
Ap1g2 A G 14: 55,099,076 V787A probably benign Het
Areg G T 5: 91,144,449 A203S probably damaging Het
Asb13 A T 13: 3,643,479 D79V probably damaging Het
Atad2b C T 12: 4,965,855 T527I probably damaging Het
Auts2 T G 5: 131,443,794 probably benign Het
Ceacam3 T A 7: 17,151,576 S35T probably damaging Het
Crebzf T C 7: 90,444,134 probably benign Het
Cttnbp2 G T 6: 18,381,098 N1366K probably benign Het
Cubn C A 2: 13,388,939 C1417F probably damaging Het
Dot1l C T 10: 80,790,793 P162S probably benign Het
Eps8l1 A G 7: 4,477,896 S613G possibly damaging Het
Erich6 T G 3: 58,625,116 I357L probably benign Het
Foxj3 T A 4: 119,619,958 S288T possibly damaging Het
Gls2 T G 10: 128,204,709 Y326* probably null Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm7535 T C 17: 17,911,799 probably benign Het
Gxylt2 T G 6: 100,787,218 L288R probably damaging Het
Kdm4a T C 4: 118,160,501 Y456C probably damaging Het
Mgat4c T A 10: 102,389,279 F451L possibly damaging Het
Mrpl20 G A 4: 155,803,705 R17H probably damaging Het
Mtf2 A G 5: 108,104,499 T465A possibly damaging Het
Mycbp2 A C 14: 103,346,321 L66R probably benign Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Nr2e1 A T 10: 42,571,487 Y176* probably null Het
Obscn T C 11: 59,012,715 T7628A possibly damaging Het
Olfr1353 A T 10: 78,970,556 K302N possibly damaging Het
Pitx2 T G 3: 129,215,840 V129G probably damaging Het
Polr2e A G 10: 80,038,063 probably benign Het
Ppard A G 17: 28,298,858 D300G probably damaging Het
Ppp1r27 A G 11: 120,550,917 V46A probably benign Het
Prex2 T A 1: 11,107,678 V332E probably damaging Het
Prss30 T G 17: 23,972,776 Y257S probably benign Het
Ptprd T C 4: 75,982,626 E1082G probably damaging Het
Rab3c T A 13: 110,181,077 R89S probably damaging Het
Rimbp2 A G 5: 128,797,381 V389A possibly damaging Het
Rims1 T A 1: 22,596,542 R119S probably damaging Het
Sema3b T C 9: 107,603,337 H137R probably null Het
Sf3b4 G C 3: 96,173,642 A89P probably damaging Het
Sgta T A 10: 81,046,247 Q298L probably damaging Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Sry T A Y: 2,662,982 D226V unknown Het
Sv2a A G 3: 96,185,458 E158G possibly damaging Het
Sytl2 A G 7: 90,381,863 probably benign Het
Thbs3 T A 3: 89,217,976 probably benign Het
Top3a A T 11: 60,762,539 N56K possibly damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Tyk2 T C 9: 21,109,381 D918G probably damaging Het
Uqcrh A G 4: 116,067,284 probably benign Het
Vmn1r61 A G 7: 5,610,815 S167P probably damaging Het
Wdr25 C A 12: 109,026,440 H74N probably damaging Het
Zfp458 T C 13: 67,256,318 N686D probably benign Het
Zfp574 T A 7: 25,081,090 H512Q probably damaging Het
Zfp976 A T 7: 42,613,478 Y312N probably benign Het
Zscan4c G A 7: 11,009,535 V354I probably benign Het
Other mutations in Epc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Epc1 APN 18 6450515 missense probably damaging 1.00
IGL00930:Epc1 APN 18 6449196 missense probably benign
IGL01637:Epc1 APN 18 6439724 missense probably benign 0.22
IGL01929:Epc1 APN 18 6449217 missense possibly damaging 0.94
IGL01993:Epc1 APN 18 6449136 missense possibly damaging 0.83
IGL02234:Epc1 APN 18 6439938 missense probably damaging 1.00
IGL02262:Epc1 APN 18 6437278 missense probably damaging 1.00
IGL02746:Epc1 APN 18 6454317 missense probably benign 0.09
PIT4131001:Epc1 UTSW 18 6449246 missense probably damaging 1.00
R0101:Epc1 UTSW 18 6462998 splice site probably benign
R0230:Epc1 UTSW 18 6440168 missense probably damaging 1.00
R0310:Epc1 UTSW 18 6440202 splice site probably benign
R0959:Epc1 UTSW 18 6453657 missense probably damaging 1.00
R1172:Epc1 UTSW 18 6490525 missense probably damaging 0.99
R1445:Epc1 UTSW 18 6452360 missense probably damaging 1.00
R1576:Epc1 UTSW 18 6452366 missense possibly damaging 0.49
R1640:Epc1 UTSW 18 6441175 nonsense probably null
R2128:Epc1 UTSW 18 6462954 missense probably damaging 1.00
R3763:Epc1 UTSW 18 6440091 missense possibly damaging 0.81
R3883:Epc1 UTSW 18 6452258 missense possibly damaging 0.67
R4184:Epc1 UTSW 18 6453578 missense possibly damaging 0.65
R4258:Epc1 UTSW 18 6450130 missense probably benign 0.21
R4585:Epc1 UTSW 18 6441157 nonsense probably null
R4586:Epc1 UTSW 18 6449138 missense possibly damaging 0.88
R4894:Epc1 UTSW 18 6449011 missense probably benign
R5314:Epc1 UTSW 18 6462969 missense probably damaging 1.00
R5335:Epc1 UTSW 18 6490689 intron probably benign
R5344:Epc1 UTSW 18 6450614 missense probably benign 0.03
R5620:Epc1 UTSW 18 6448917 missense probably benign 0.01
R7567:Epc1 UTSW 18 6450084 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTAACACGTACCGACTCCTC -3'
(R):5'- GCACAGTGGAGTTTTAATGTCC -3'

Sequencing Primer
(F):5'- CCCGGTTTATCGAGGCGTATTC -3'
(R):5'- CAGTGGAGTTTTAATGTCCGCCATG -3'
Posted On2016-07-22