Incidental Mutation 'R5305:Sry'
ID 404535
Institutional Source Beutler Lab
Gene Symbol Sry
Ensembl Gene ENSMUSG00000069036
Gene Name sex determining region of Chr Y
Synonyms Tdy, Tdf
MMRRC Submission 042888-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.318) question?
Stock # R5305 (G1)
Quality Score 179
Status Validated
Chromosome Y
Chromosomal Location 2662471-2663658 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 2662982 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 226 (D226V)
Ref Sequence ENSEMBL: ENSMUSP00000088717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091178]
AlphaFold Q05738
Predicted Effect unknown
Transcript: ENSMUST00000091178
AA Change: D226V
SMART Domains Protein: ENSMUSP00000088717
Gene: ENSMUSG00000069036
AA Change: D226V

DomainStartEndE-ValueType
HMG 4 74 2.76e-24 SMART
low complexity region 144 366 N/A INTRINSIC
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (67/68)
MGI Phenotype PHENOTYPE: Variations in expression of alleles on specific backgrounds result in partial and/or complete male to female sex reversal. Deletion of alleles results in XY females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G A 15: 82,059,219 V11M possibly damaging Het
Acot8 A G 2: 164,795,765 V179A probably benign Het
Actb A G 5: 142,904,230 I194T probably benign Het
Ap1g2 A G 14: 55,099,076 V787A probably benign Het
Areg G T 5: 91,144,449 A203S probably damaging Het
Asb13 A T 13: 3,643,479 D79V probably damaging Het
Atad2b C T 12: 4,965,855 T527I probably damaging Het
Auts2 T G 5: 131,443,794 probably benign Het
Ceacam3 T A 7: 17,151,576 S35T probably damaging Het
Crebzf T C 7: 90,444,134 probably benign Het
Cttnbp2 G T 6: 18,381,098 N1366K probably benign Het
Cubn C A 2: 13,388,939 C1417F probably damaging Het
Dot1l C T 10: 80,790,793 P162S probably benign Het
Epc1 G A 18: 6,490,690 probably benign Het
Eps8l1 A G 7: 4,477,896 S613G possibly damaging Het
Erich6 T G 3: 58,625,116 I357L probably benign Het
Foxj3 T A 4: 119,619,958 S288T possibly damaging Het
Gls2 T G 10: 128,204,709 Y326* probably null Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm7535 T C 17: 17,911,799 probably benign Het
Gxylt2 T G 6: 100,787,218 L288R probably damaging Het
Kdm4a T C 4: 118,160,501 Y456C probably damaging Het
Mgat4c T A 10: 102,389,279 F451L possibly damaging Het
Mrpl20 G A 4: 155,803,705 R17H probably damaging Het
Mtf2 A G 5: 108,104,499 T465A possibly damaging Het
Mycbp2 A C 14: 103,346,321 L66R probably benign Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Nr2e1 A T 10: 42,571,487 Y176* probably null Het
Obscn T C 11: 59,012,715 T7628A possibly damaging Het
Olfr1353 A T 10: 78,970,556 K302N possibly damaging Het
Pitx2 T G 3: 129,215,840 V129G probably damaging Het
Polr2e A G 10: 80,038,063 probably benign Het
Ppard A G 17: 28,298,858 D300G probably damaging Het
Ppp1r27 A G 11: 120,550,917 V46A probably benign Het
Prex2 T A 1: 11,107,678 V332E probably damaging Het
Prss30 T G 17: 23,972,776 Y257S probably benign Het
Ptprd T C 4: 75,982,626 E1082G probably damaging Het
Rab3c T A 13: 110,181,077 R89S probably damaging Het
Rimbp2 A G 5: 128,797,381 V389A possibly damaging Het
Rims1 T A 1: 22,596,542 R119S probably damaging Het
Sema3b T C 9: 107,603,337 H137R probably null Het
Sf3b4 G C 3: 96,173,642 A89P probably damaging Het
Sgta T A 10: 81,046,247 Q298L probably damaging Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Sv2a A G 3: 96,185,458 E158G possibly damaging Het
Sytl2 A G 7: 90,381,863 probably benign Het
Thbs3 T A 3: 89,217,976 probably benign Het
Top3a A T 11: 60,762,539 N56K possibly damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Tyk2 T C 9: 21,109,381 D918G probably damaging Het
Uqcrh A G 4: 116,067,284 probably benign Het
Vmn1r61 A G 7: 5,610,815 S167P probably damaging Het
Wdr25 C A 12: 109,026,440 H74N probably damaging Het
Zfp458 T C 13: 67,256,318 N686D probably benign Het
Zfp574 T A 7: 25,081,090 H512Q probably damaging Het
Zfp976 A T 7: 42,613,478 Y312N probably benign Het
Zscan4c G A 7: 11,009,535 V354I probably benign Het
Other mutations in Sry
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4304:Sry UTSW Y 2662837 small insertion probably benign
FR4340:Sry UTSW Y 2662824 small insertion probably benign
FR4342:Sry UTSW Y 2662835 small insertion probably benign
FR4342:Sry UTSW Y 2662836 small insertion probably benign
FR4342:Sry UTSW Y 2662839 small insertion probably benign
FR4342:Sry UTSW Y 2663146 small deletion probably benign
FR4449:Sry UTSW Y 2662818 small insertion probably benign
FR4449:Sry UTSW Y 2662832 small insertion probably benign
FR4589:Sry UTSW Y 2662818 small insertion probably benign
FR4737:Sry UTSW Y 2662837 small insertion probably benign
FR4737:Sry UTSW Y 2662838 small insertion probably benign
FR4737:Sry UTSW Y 2663195 small deletion probably benign
FR4976:Sry UTSW Y 2662841 small insertion probably benign
R0288:Sry UTSW Y 2662818 missense unknown
R0506:Sry UTSW Y 2662864 missense unknown
R0690:Sry UTSW Y 2662944 small deletion probably benign
R0784:Sry UTSW Y 2662731 missense unknown
R1373:Sry UTSW Y 2662864 missense unknown
R1555:Sry UTSW Y 2662975 missense unknown
R1638:Sry UTSW Y 2663149 missense unknown
R2110:Sry UTSW Y 2662901 missense unknown
R2212:Sry UTSW Y 2663339 missense probably damaging 0.99
R3150:Sry UTSW Y 2662944 small deletion probably benign
R3552:Sry UTSW Y 2663141 missense unknown
R4877:Sry UTSW Y 2662864 missense unknown
R4888:Sry UTSW Y 2663105 missense unknown
R5028:Sry UTSW Y 2663312 missense probably damaging 0.97
R5266:Sry UTSW Y 2662975 missense unknown
R5335:Sry UTSW Y 2663647 missense probably benign 0.08
R5587:Sry UTSW Y 2662625 missense unknown
R5915:Sry UTSW Y 2662612 missense unknown
R6183:Sry UTSW Y 2662975 missense unknown
R6184:Sry UTSW Y 2662975 missense unknown
R6187:Sry UTSW Y 2662975 missense unknown
R6976:Sry UTSW Y 2662938 missense unknown
R7358:Sry UTSW Y 2662638 small deletion probably benign
R7632:Sry UTSW Y 2662638 small deletion probably benign
R7678:Sry UTSW Y 2663248 missense possibly damaging 0.83
R7737:Sry UTSW Y 2662638 small deletion probably benign
R7812:Sry UTSW Y 2662638 small deletion probably benign
R7829:Sry UTSW Y 2662638 small deletion probably benign
R8005:Sry UTSW Y 2663303 missense possibly damaging 0.88
R8028:Sry UTSW Y 2662638 small deletion probably benign
R8082:Sry UTSW Y 2662589 missense unknown
R8212:Sry UTSW Y 2662638 small deletion probably benign
R8223:Sry UTSW Y 2663204 missense unknown
R8252:Sry UTSW Y 2663298 missense possibly damaging 0.91
R8390:Sry UTSW Y 2662638 small deletion probably benign
R9027:Sry UTSW Y 2662638 small deletion probably benign
R9429:Sry UTSW Y 2662638 small deletion probably benign
RF002:Sry UTSW Y 2662564 small deletion probably benign
RF006:Sry UTSW Y 2662638 small deletion probably benign
RF008:Sry UTSW Y 2662826 small insertion probably benign
RF040:Sry UTSW Y 2662590 small insertion probably benign
RF063:Sry UTSW Y 2662595 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGTAGGTAAGCTGCTGGTCG -3'
(R):5'- AGCCTGTTGATATCCCCACTG -3'

Sequencing Primer
(F):5'- AAGCTGCTGGTCGTGGAAC -3'
(R):5'- GCAGCAACAGCAGTTCTATG -3'
Posted On 2016-07-22