Mutagenetix > Incidental Mutations

Incidental Mutation 'R0009:Il1a'

40454

Institutional Source

Beutler Lab

Gene Symbol

Il1a

Ensembl Gene

ENSMUSG00000027399

Gene Name

interleukin 1 alpha

Synonyms

Il-1a

MMRRC Submission

038304-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0009 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

129299610-129309972 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 129309074 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 10 (D10N)

Ref Sequence

ENSEMBL: ENSMUSP00000028882 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028882]

Predicted Effect

probably damaging
Transcript: ENSMUST00000028882
AA Change: D10N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000028882
Gene: ENSMUSG00000027399
AA Change: D10N

Domain	Start	End	E-Value	Type
Pfam:IL1_propep	1	111	2.2e-38	PFAM
IL1	131	270	8.14e-70	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144178

Meta Mutation Damage Score

0.5222

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.7%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the interleukin 1 cytokine family. This cytokine is a pleiotropic cytokine involved in various immune responses, inflammatory processes, and hematopoiesis. This cytokine is produced by monocytes and macrophages as a proprotein, which is proteolytically processed and released in response to cell injury, and thus induces apoptosis. This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. It has been suggested that the polymorphism of these genes is associated with rheumatoid arthritis and Alzheimer's disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal tumor vascularization, decreased metastatic potential, and decreased interleukin-1 beta secretion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A1bg	T	G	15: 60,919,633		probably benign	Het
Abcg4	T	G	9: 44,277,649		probably benign	Het
Afm	C	A	5: 90,545,384		probably benign	Het
Ahrr	G	A	13: 74,283,024		probably benign	Het
Aplnr	T	A	2: 85,137,276		probably null	Het
Arih2	T	A	9: 108,611,727	H264L	probably damaging	Het
Atp1a1	A	T	3: 101,579,835	I886N	possibly damaging	Het
Bmf	A	T	2: 118,549,622	V14E	probably damaging	Het
Ccdc116	T	C	16: 17,144,039	E15G	probably damaging	Het
Ccdc175	T	C	12: 72,135,965	N427D	possibly damaging	Het
Cfap53	A	G	18: 74,299,176	H45R	probably benign	Het
Chd3	A	G	11: 69,349,906	L1569P	probably damaging	Het
Cntn2	G	A	1: 132,516,180	Q457*	probably null	Het
Coro1a	A	T	7: 126,701,413		probably benign	Het
Cracr2b	T	A	7: 141,463,759	L91Q	probably damaging	Het
Ctdspl	T	C	9: 119,020,046		probably null	Het
Dip2b	T	A	15: 100,169,312	L565Q	probably damaging	Het
Dip2c	T	A	13: 9,621,903	C1004S	probably damaging	Het
Dnah11	A	T	12: 118,045,522	I2135N	possibly damaging	Het
Dnah14	A	G	1: 181,769,407		probably benign	Het
Dnase1	T	C	16: 4,038,946	V147A	probably damaging	Het
Dusp8	T	C	7: 142,082,054		probably benign	Het
Fer1l6	T	C	15: 58,662,787	Y1828H	probably damaging	Het
Flvcr1	A	G	1: 191,008,191	V544A	probably benign	Het
Fsd1l	T	C	4: 53,687,209	V311A	probably benign	Het
Glud1	G	A	14: 34,334,268	G300S	probably benign	Het
Gm4847	C	T	1: 166,630,486	V433I	probably benign	Het
Gstm3	T	G	3: 107,967,840	Y62S	probably damaging	Het
Gtse1	C	T	15: 85,862,435	P151S	probably benign	Het
Herc2	T	C	7: 56,207,812	S4048P	probably benign	Het
Hp1bp3	T	A	4: 138,221,683	I19K	probably benign	Het
Htr7	C	A	19: 36,041,540		probably benign	Het
Il22ra2	A	T	10: 19,624,458	N39I	probably damaging	Het
Kcnn4	T	C	7: 24,379,255	C267R	possibly damaging	Het
Larp1	A	G	11: 58,055,473	K879R	possibly damaging	Het
Lcn5	T	A	2: 25,661,405		probably benign	Het
Lep	T	A	6: 29,068,972	C7*	probably null	Het
Magi2	A	T	5: 20,611,055	Y747F	probably benign	Het
Mast4	T	C	13: 102,742,058	T1223A	probably damaging	Het
Mcc	C	T	18: 44,445,933	E803K	probably damaging	Het
Mtmr4	T	C	11: 87,611,508	I796T	probably benign	Het
Myef2	A	T	2: 125,108,978	D312E	probably benign	Het
Myl3	A	C	9: 110,767,929	D119A	probably damaging	Het
Myo19	T	A	11: 84,888,169		probably null	Het
Naa15	T	G	3: 51,470,219	H763Q	probably damaging	Het
Pde5a	C	T	3: 122,824,902		probably benign	Het
Plpp2	C	T	10: 79,527,244	R184H	probably benign	Het
Rab19	T	G	6: 39,389,687	L179V	probably damaging	Het
Rims2	T	A	15: 39,534,966	M1087K	probably damaging	Het
Riox2	C	A	16: 59,489,367	D361E	probably benign	Het
Sh3rf1	T	A	8: 61,226,293	V123E	probably damaging	Het
Slc35e1	A	T	8: 72,484,709	N318K	probably damaging	Het
Slc9a2	A	T	1: 40,763,602	E604V	probably benign	Het
Srp72	T	C	5: 76,987,885	S221P	probably damaging	Het
Tbx19	A	T	1: 165,160,520	S15T	possibly damaging	Het
Tcea2	A	G	2: 181,685,817	T112A	probably benign	Het
Tesk1	T	A	4: 43,445,368	D230E	probably damaging	Het
Tm4sf5	C	T	11: 70,510,712	A179V	probably damaging	Het
Tnr	G	T	1: 159,852,416	G320V	probably damaging	Het
Trappc11	A	T	8: 47,503,320	C874S	possibly damaging	Het
Trpm3	T	A	19: 22,914,446	Y885N	probably damaging	Het
Unc5a	T	A	13: 55,002,879	C505S	probably damaging	Het
Vmn1r28	G	A	6: 58,265,717	A182T	probably benign	Het
Xpo5	T	C	17: 46,204,786		probably benign	Het
Zfp637	C	A	6: 117,845,668	H252Q	probably damaging	Het
Zfp646	T	A	7: 127,880,731	D693E	probably damaging	Het

Other mutations in Il1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01663:Il1a	APN	2	129304717	missense	probably benign
IGL01726:Il1a	APN	2	129304720	missense	possibly damaging	0.47
IGL02451:Il1a	APN	2	129306655	missense	probably damaging	0.98
IGL02537:Il1a	APN	2	129309076	missense	probably damaging	0.98
R0009:Il1a	UTSW	2	129309074	missense	probably damaging	0.99
R0759:Il1a	UTSW	2	129304687	missense	probably damaging	1.00
R1388:Il1a	UTSW	2	129306581	missense	possibly damaging	0.92
R1521:Il1a	UTSW	2	129304741	missense	possibly damaging	0.83
R1699:Il1a	UTSW	2	129302893	missense	probably damaging	0.98
R3833:Il1a	UTSW	2	129306679	missense	possibly damaging	0.81
R4591:Il1a	UTSW	2	129306527	missense	probably damaging	1.00
R4643:Il1a	UTSW	2	129304703	missense	probably benign
R5433:Il1a	UTSW	2	129307901	missense	possibly damaging	0.79
R5572:Il1a	UTSW	2	129307918	missense	possibly damaging	0.83
R7345:Il1a	UTSW	2	129304773	missense	probably benign
R7876:Il1a	UTSW	2	129300842	missense	probably damaging	1.00
R8116:Il1a	UTSW	2	129302944	missense	probably damaging	1.00
R8162:Il1a	UTSW	2	129306557	missense	possibly damaging	0.92
R8248:Il1a	UTSW	2	129302961	missense	probably benign
RF003:Il1a	UTSW	2	129302932	missense	possibly damaging	0.56

Predicted Primers

PCR Primer
(F):5'- TGGGAACAGGCTCTACTGAGAACAG -3'
(R):5'- TATAAGGCAGACACCCCACTCTGG -3'

Sequencing Primer
(F):5'- CACAATGGATGACTGGTGTTCC -3'
(R):5'- GCCTACTATGTGTGATGCAATAGAC -3'

Posted On

2013-05-23