Incidental Mutation 'R5306:Exosc10'
ID404549
Institutional Source Beutler Lab
Gene Symbol Exosc10
Ensembl Gene ENSMUSG00000017264
Gene Nameexosome component 10
SynonymsPmscl2, PM-Scl, p3, p2, PM/Scl-100, RRP6, p4
MMRRC Submission 042889-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R5306 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location148558429-148582401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 148562392 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 153 (V153A)
Ref Sequence ENSEMBL: ENSMUSP00000075401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017408] [ENSMUST00000076022] [ENSMUST00000097781] [ENSMUST00000103221]
Predicted Effect probably benign
Transcript: ENSMUST00000017408
AA Change: V153A

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000017408
Gene: ENSMUSG00000017264
AA Change: V153A

DomainStartEndE-ValueType
Pfam:PMC2NT 44 133 2.7e-26 PFAM
low complexity region 219 230 N/A INTRINSIC
35EXOc 288 456 7.84e-53 SMART
HRDC 503 583 8.24e-25 SMART
low complexity region 745 760 N/A INTRINSIC
coiled coil region 769 800 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000076022
AA Change: V153A

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000075401
Gene: ENSMUSG00000017264
AA Change: V153A

DomainStartEndE-ValueType
Pfam:PMC2NT 43 134 5.1e-30 PFAM
low complexity region 219 230 N/A INTRINSIC
35EXOc 288 456 7.84e-53 SMART
HRDC 503 583 8.24e-25 SMART
low complexity region 720 735 N/A INTRINSIC
coiled coil region 744 775 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097781
AA Change: V153A

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000095388
Gene: ENSMUSG00000017264
AA Change: V153A

DomainStartEndE-ValueType
Pfam:PMC2NT 43 134 1.4e-30 PFAM
low complexity region 219 230 N/A INTRINSIC
35EXOc 288 456 7.84e-53 SMART
HRDC 503 583 8.24e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103221
SMART Domains Protein: ENSMUSP00000099510
Gene: ENSMUSG00000028991

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
low complexity region 179 191 N/A INTRINSIC
low complexity region 277 288 N/A INTRINSIC
low complexity region 774 790 N/A INTRINSIC
DUF3385 854 1024 1.51e-93 SMART
low complexity region 1279 1300 N/A INTRINSIC
Pfam:FAT 1513 1908 2.3e-134 PFAM
Rapamycin_bind 2015 2114 7.94e-61 SMART
PI3Kc 2183 2484 8.84e-121 SMART
FATC 2517 2549 2.11e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173767
Meta Mutation Damage Score 0.1308 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 97% (64/66)
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele appear phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A G 19: 29,729,830 probably benign Het
Adam29 T A 8: 55,871,757 D554V probably damaging Het
Ankrd44 G A 1: 54,926,203 probably benign Het
Api5 A T 2: 94,423,466 C297* probably null Het
Asb14 G A 14: 26,911,909 C357Y probably damaging Het
Brdt T A 5: 107,345,144 D112E probably damaging Het
Capsl C A 15: 9,457,790 Q32K probably benign Het
Ccdc106 A G 7: 5,058,097 D81G probably damaging Het
Cep104 C A 4: 154,006,242 T884K probably benign Het
Cmbl T C 15: 31,582,069 Y71H probably damaging Het
Crybg3 A T 16: 59,559,993 probably benign Het
Dynlt1c T C 17: 6,601,811 M1T probably null Het
Erbb2 T C 11: 98,428,206 S574P probably benign Het
Faxc G T 4: 21,931,557 probably benign Het
Fcgbp A G 7: 28,091,818 T835A probably damaging Het
Fmo5 G T 3: 97,641,760 M241I probably benign Het
Gabra1 A C 11: 42,133,552 I432S probably benign Het
Gfap A G 11: 102,895,748 probably null Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm12185 T A 11: 48,915,555 M270L probably benign Het
Gm14443 T C 2: 175,169,579 N358S possibly damaging Het
Gm6583 T C 5: 112,355,044 R265G probably benign Het
Gpr3 C T 4: 133,211,179 V61M probably damaging Het
Herc2 C T 7: 56,184,961 T3229M probably damaging Het
Ifit3 A G 19: 34,587,807 Y251C probably damaging Het
Inf2 G A 12: 112,601,553 V180I probably benign Het
Ints11 T C 4: 155,875,208 Y91H probably damaging Het
Ints4 A C 7: 97,509,678 D419A probably damaging Het
Kmt2e T C 5: 23,499,333 S1175P probably damaging Het
Mki67 A T 7: 135,714,001 V44E probably damaging Het
Mrgprb13 A T 7: 48,312,192 noncoding transcript Het
Myh2 T C 11: 67,186,556 L839P probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Olfr723 A G 14: 49,929,550 probably benign Het
Olfr814 A C 10: 129,873,941 I272R probably damaging Het
Pced1a T A 2: 130,419,171 H422L probably benign Het
Plpp1 G T 13: 112,851,555 probably null Het
Plxna4 T C 6: 32,206,121 Y949C probably damaging Het
Polg2 G A 11: 106,778,970 T158I probably damaging Het
Prss38 A T 11: 59,372,995 I297K probably benign Het
Psph A G 5: 129,769,367 L98P probably damaging Het
Rab11b G A 17: 33,760,269 probably benign Het
Rsf1 CGGCGGC CGGCGGCGGGGGCGGC 7: 97,579,929 probably benign Het
Serpine3 G A 14: 62,670,933 A137T probably damaging Het
Sh3bp4 T C 1: 89,144,275 F282L probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slco2b1 T A 7: 99,688,991 Y109F possibly damaging Het
Slfn10-ps T A 11: 83,035,529 noncoding transcript Het
Smc5 A G 19: 23,259,645 probably null Het
Smyd4 A G 11: 75,402,158 N638S probably benign Het
Stxbp5 T C 10: 9,799,991 E628G probably damaging Het
Tmem236 A T 2: 14,219,164 K255* probably null Het
Ttc29 T A 8: 78,251,910 probably null Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Tyr A G 7: 87,438,014 I430T probably damaging Het
Uckl1 A G 2: 181,574,367 probably null Het
Vmn2r52 A C 7: 10,170,745 I389R possibly damaging Het
Wdr62 A T 7: 30,265,263 F352Y possibly damaging Het
Wdr70 T C 15: 7,924,273 D379G probably benign Het
Zfp408 T A 2: 91,646,345 M155L probably benign Het
Zfp459 T A 13: 67,413,130 Q66H probably damaging Het
Zfp870 C A 17: 32,883,653 G234V probably damaging Het
Other mutations in Exosc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01400:Exosc10 APN 4 148565271 missense probably damaging 1.00
IGL01591:Exosc10 APN 4 148562887 unclassified probably benign
IGL01990:Exosc10 APN 4 148566410 missense possibly damaging 0.83
IGL02137:Exosc10 APN 4 148561133 missense probably damaging 0.97
IGL02186:Exosc10 APN 4 148565298 missense probably damaging 0.96
IGL02412:Exosc10 APN 4 148568392 missense probably benign 0.15
IGL02880:Exosc10 APN 4 148576183 missense probably damaging 1.00
R0172:Exosc10 UTSW 4 148565357 missense probably benign 0.02
R0267:Exosc10 UTSW 4 148562756 missense probably damaging 1.00
R0592:Exosc10 UTSW 4 148581113 missense probably benign
R1122:Exosc10 UTSW 4 148566364 missense possibly damaging 0.86
R1218:Exosc10 UTSW 4 148570401 missense probably damaging 1.00
R1498:Exosc10 UTSW 4 148581786 missense possibly damaging 0.66
R1591:Exosc10 UTSW 4 148568383 missense probably benign 0.04
R1719:Exosc10 UTSW 4 148568503 missense probably damaging 1.00
R1760:Exosc10 UTSW 4 148578469 nonsense probably null
R3727:Exosc10 UTSW 4 148565277 missense probably damaging 1.00
R3842:Exosc10 UTSW 4 148563865 nonsense probably null
R3876:Exosc10 UTSW 4 148572919 missense probably benign 0.00
R4476:Exosc10 UTSW 4 148565324 missense probably damaging 0.98
R4750:Exosc10 UTSW 4 148562394 missense possibly damaging 0.69
R5438:Exosc10 UTSW 4 148566342 nonsense probably null
R5835:Exosc10 UTSW 4 148565387 missense probably damaging 1.00
R5925:Exosc10 UTSW 4 148573362 missense probably benign 0.01
R6116:Exosc10 UTSW 4 148573353 missense probably benign 0.08
R6217:Exosc10 UTSW 4 148582311 synonymous probably null
R6365:Exosc10 UTSW 4 148561105 missense probably benign 0.13
R6495:Exosc10 UTSW 4 148562872 missense probably benign 0.45
R6498:Exosc10 UTSW 4 148573338 missense probably benign
R6772:Exosc10 UTSW 4 148581134 missense probably damaging 1.00
R7297:Exosc10 UTSW 4 148580377 missense probably damaging 1.00
R7523:Exosc10 UTSW 4 148563842 critical splice acceptor site probably null
R7698:Exosc10 UTSW 4 148558498 missense probably benign
Z1177:Exosc10 UTSW 4 148565386 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCACGTATTTCTGTGACTACG -3'
(R):5'- CTCAGGACCACACATTTGGAATG -3'

Sequencing Primer
(F):5'- ACTACGTTTCTTGAGGATGTCAG -3'
(R):5'- GGGTTCAAGTGCCACATGG -3'
Posted On2016-07-22