Incidental Mutation 'R0009:Tcea2'
ID 40455
Institutional Source Beutler Lab
Gene Symbol Tcea2
Ensembl Gene ENSMUSG00000059540
Gene Name transcription elongation factor A (SII), 2
Synonyms SII-T1, Tceat, S-II-T1
MMRRC Submission 038304-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.216) question?
Stock # R0009 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 181322103-181329864 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 181327610 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 112 (T112A)
Ref Sequence ENSEMBL: ENSMUSP00000119646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002532] [ENSMUST00000103042] [ENSMUST00000108769] [ENSMUST00000108771] [ENSMUST00000108772] [ENSMUST00000108776] [ENSMUST00000108778] [ENSMUST00000129745] [ENSMUST00000165416] [ENSMUST00000108779]
AlphaFold Q9QVN7
Predicted Effect probably benign
Transcript: ENSMUST00000002532
SMART Domains Protein: ENSMUSP00000002532
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
RGS 90 206 2.73e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103042
AA Change: T119A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099331
Gene: ENSMUSG00000059540
AA Change: T119A

DomainStartEndE-ValueType
TFS2N 7 81 2.51e-25 SMART
low complexity region 114 129 N/A INTRINSIC
TFS2M 136 237 4.14e-51 SMART
ZnF_C2C2 259 298 7.37e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108769
SMART Domains Protein: ENSMUSP00000104400
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
Pfam:RGS 90 160 4.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108771
SMART Domains Protein: ENSMUSP00000104402
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
RGS 68 184 2.73e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108772
SMART Domains Protein: ENSMUSP00000104403
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
RGS 68 184 2.73e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108776
SMART Domains Protein: ENSMUSP00000104406
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
RGS 90 206 2.73e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108778
SMART Domains Protein: ENSMUSP00000104408
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 66 78 N/A INTRINSIC
RGS 117 233 2.73e-43 SMART
Predicted Effect unknown
Transcript: ENSMUST00000129006
AA Change: T116A
SMART Domains Protein: ENSMUSP00000120083
Gene: ENSMUSG00000059540
AA Change: T116A

DomainStartEndE-ValueType
Pfam:Med26 27 77 5.1e-17 PFAM
low complexity region 112 127 N/A INTRINSIC
TFS2M 134 235 4.14e-51 SMART
ZnF_C2C2 257 296 7.37e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129745
AA Change: T112A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119646
Gene: ENSMUSG00000059540
AA Change: T112A

DomainStartEndE-ValueType
Pfam:Med26 21 73 2.1e-20 PFAM
low complexity region 107 122 N/A INTRINSIC
TFS2M 129 230 4.14e-51 SMART
ZnF_C2C2 252 291 7.37e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126623
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130712
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126844
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124776
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143510
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136145
Predicted Effect probably benign
Transcript: ENSMUST00000144476
SMART Domains Protein: ENSMUSP00000120723
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
Pfam:RGS 1 49 3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165416
SMART Domains Protein: ENSMUSP00000129026
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
RGS 90 206 2.73e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108779
SMART Domains Protein: ENSMUSP00000104409
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in the nucleus, where it functions as an SII class transcription elongation factor. Elongation factors in this class are responsible for releasing RNA polymerase II ternary complexes from transcriptional arrest at template-encoded arresting sites. The encoded protein has been shown to interact with general transcription factor IIB, a basal transcription factor. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T G 15: 60,791,482 (GRCm39) probably benign Het
Abcg4 T G 9: 44,188,946 (GRCm39) probably benign Het
Afm C A 5: 90,693,243 (GRCm39) probably benign Het
Ahrr G A 13: 74,431,143 (GRCm39) probably benign Het
Aplnr T A 2: 84,967,620 (GRCm39) probably null Het
Arih2 T A 9: 108,488,926 (GRCm39) H264L probably damaging Het
Atp1a1 A T 3: 101,487,151 (GRCm39) I886N possibly damaging Het
Bmf A T 2: 118,380,103 (GRCm39) V14E probably damaging Het
Ccdc116 T C 16: 16,961,903 (GRCm39) E15G probably damaging Het
Ccdc175 T C 12: 72,182,739 (GRCm39) N427D possibly damaging Het
Cfap53 A G 18: 74,432,247 (GRCm39) H45R probably benign Het
Chd3 A G 11: 69,240,732 (GRCm39) L1569P probably damaging Het
Cntn2 G A 1: 132,443,918 (GRCm39) Q457* probably null Het
Coro1a A T 7: 126,300,585 (GRCm39) probably benign Het
Cracr2b T A 7: 141,043,672 (GRCm39) L91Q probably damaging Het
Ctdspl T C 9: 118,849,114 (GRCm39) probably null Het
Dip2b T A 15: 100,067,193 (GRCm39) L565Q probably damaging Het
Dip2c T A 13: 9,671,939 (GRCm39) C1004S probably damaging Het
Dnah11 A T 12: 118,009,257 (GRCm39) I2135N possibly damaging Het
Dnah14 A G 1: 181,596,972 (GRCm39) probably benign Het
Dnase1 T C 16: 3,856,810 (GRCm39) V147A probably damaging Het
Dusp8 T C 7: 141,635,791 (GRCm39) probably benign Het
Fer1l6 T C 15: 58,534,636 (GRCm39) Y1828H probably damaging Het
Flvcr1 A G 1: 190,740,388 (GRCm39) V544A probably benign Het
Fsd1l T C 4: 53,687,209 (GRCm39) V311A probably benign Het
Glud1 G A 14: 34,056,225 (GRCm39) G300S probably benign Het
Gm4847 C T 1: 166,458,055 (GRCm39) V433I probably benign Het
Gstm3 T G 3: 107,875,156 (GRCm39) Y62S probably damaging Het
Gtse1 C T 15: 85,746,636 (GRCm39) P151S probably benign Het
Herc2 T C 7: 55,857,560 (GRCm39) S4048P probably benign Het
Hp1bp3 T A 4: 137,948,994 (GRCm39) I19K probably benign Het
Htr7 C A 19: 36,018,940 (GRCm39) probably benign Het
Il1a C T 2: 129,150,994 (GRCm39) D10N probably damaging Het
Il22ra2 A T 10: 19,500,206 (GRCm39) N39I probably damaging Het
Kcnn4 T C 7: 24,078,680 (GRCm39) C267R possibly damaging Het
Larp1 A G 11: 57,946,299 (GRCm39) K879R possibly damaging Het
Lcn5 T A 2: 25,551,417 (GRCm39) probably benign Het
Lep T A 6: 29,068,971 (GRCm39) C7* probably null Het
Magi2 A T 5: 20,816,053 (GRCm39) Y747F probably benign Het
Mast4 T C 13: 102,878,566 (GRCm39) T1223A probably damaging Het
Mcc C T 18: 44,579,000 (GRCm39) E803K probably damaging Het
Mtmr4 T C 11: 87,502,334 (GRCm39) I796T probably benign Het
Myef2 A T 2: 124,950,898 (GRCm39) D312E probably benign Het
Myl3 A C 9: 110,596,997 (GRCm39) D119A probably damaging Het
Myo19 T A 11: 84,778,995 (GRCm39) probably null Het
Naa15 T G 3: 51,377,640 (GRCm39) H763Q probably damaging Het
Pde5a C T 3: 122,618,551 (GRCm39) probably benign Het
Plpp2 C T 10: 79,363,078 (GRCm39) R184H probably benign Het
Rab19 T G 6: 39,366,621 (GRCm39) L179V probably damaging Het
Rims2 T A 15: 39,398,362 (GRCm39) M1087K probably damaging Het
Riox2 C A 16: 59,309,730 (GRCm39) D361E probably benign Het
Sh3rf1 T A 8: 61,679,327 (GRCm39) V123E probably damaging Het
Slc35e1 A T 8: 73,238,553 (GRCm39) N318K probably damaging Het
Slc9a2 A T 1: 40,802,762 (GRCm39) E604V probably benign Het
Srp72 T C 5: 77,135,732 (GRCm39) S221P probably damaging Het
Tbx19 A T 1: 164,988,089 (GRCm39) S15T possibly damaging Het
Tesk1 T A 4: 43,445,368 (GRCm39) D230E probably damaging Het
Tm4sf5 C T 11: 70,401,538 (GRCm39) A179V probably damaging Het
Tnr G T 1: 159,679,986 (GRCm39) G320V probably damaging Het
Trappc11 A T 8: 47,956,355 (GRCm39) C874S possibly damaging Het
Trpm3 T A 19: 22,891,810 (GRCm39) Y885N probably damaging Het
Unc5a T A 13: 55,150,692 (GRCm39) C505S probably damaging Het
Vmn1r28 G A 6: 58,242,702 (GRCm39) A182T probably benign Het
Xpo5 T C 17: 46,515,712 (GRCm39) probably benign Het
Zfp637 C A 6: 117,822,629 (GRCm39) H252Q probably damaging Het
Zfp646 T A 7: 127,479,903 (GRCm39) D693E probably damaging Het
Other mutations in Tcea2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02118:Tcea2 APN 2 181,327,628 (GRCm39) missense probably benign 0.02
R0513:Tcea2 UTSW 2 181,326,274 (GRCm39) missense probably benign 0.19
R0626:Tcea2 UTSW 2 181,329,431 (GRCm39) missense probably damaging 1.00
R1228:Tcea2 UTSW 2 181,326,238 (GRCm39) missense probably benign 0.11
R1540:Tcea2 UTSW 2 181,328,751 (GRCm39) missense possibly damaging 0.55
R2095:Tcea2 UTSW 2 181,328,725 (GRCm39) missense probably damaging 1.00
R4735:Tcea2 UTSW 2 181,328,514 (GRCm39) missense probably damaging 1.00
R5499:Tcea2 UTSW 2 181,322,227 (GRCm39) missense probably damaging 0.99
R7039:Tcea2 UTSW 2 181,328,711 (GRCm39) nonsense probably null
R7411:Tcea2 UTSW 2 181,328,457 (GRCm39) missense probably damaging 1.00
R9398:Tcea2 UTSW 2 181,322,243 (GRCm39) missense probably damaging 1.00
R9432:Tcea2 UTSW 2 181,322,227 (GRCm39) missense probably damaging 0.99
R9647:Tcea2 UTSW 2 181,322,984 (GRCm39) missense probably benign 0.01
R9774:Tcea2 UTSW 2 181,328,664 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCAATGCTCTACTCTGATGAGAC -3'
(R):5'- AAGACACAGATGTTGTGGTGACCC -3'

Sequencing Primer
(F):5'- ACACAGGCATTCTAGGCTG -3'
(R):5'- TGTTGTGGTGACCCCAAAAAC -3'
Posted On 2013-05-23