Incidental Mutation 'R0009:Tcea2'
ID40455
Institutional Source Beutler Lab
Gene Symbol Tcea2
Ensembl Gene ENSMUSG00000059540
Gene Nametranscription elongation factor A (SII), 2
SynonymsSII-T1, Tceat, S-II-T1
MMRRC Submission 038304-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock #R0009 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location181680310-181688071 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 181685817 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 112 (T112A)
Ref Sequence ENSEMBL: ENSMUSP00000119646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002532] [ENSMUST00000103042] [ENSMUST00000108769] [ENSMUST00000108771] [ENSMUST00000108772] [ENSMUST00000108776] [ENSMUST00000108778] [ENSMUST00000108779] [ENSMUST00000129745] [ENSMUST00000165416]
Predicted Effect probably benign
Transcript: ENSMUST00000002532
SMART Domains Protein: ENSMUSP00000002532
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
RGS 90 206 2.73e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103042
AA Change: T119A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099331
Gene: ENSMUSG00000059540
AA Change: T119A

DomainStartEndE-ValueType
TFS2N 7 81 2.51e-25 SMART
low complexity region 114 129 N/A INTRINSIC
TFS2M 136 237 4.14e-51 SMART
ZnF_C2C2 259 298 7.37e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108769
SMART Domains Protein: ENSMUSP00000104400
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
Pfam:RGS 90 160 4.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108771
SMART Domains Protein: ENSMUSP00000104402
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
RGS 68 184 2.73e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108772
SMART Domains Protein: ENSMUSP00000104403
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
RGS 68 184 2.73e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108776
SMART Domains Protein: ENSMUSP00000104406
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
RGS 90 206 2.73e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108778
SMART Domains Protein: ENSMUSP00000104408
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 66 78 N/A INTRINSIC
RGS 117 233 2.73e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108779
SMART Domains Protein: ENSMUSP00000104409
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124776
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126623
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126844
Predicted Effect unknown
Transcript: ENSMUST00000129006
AA Change: T116A
SMART Domains Protein: ENSMUSP00000120083
Gene: ENSMUSG00000059540
AA Change: T116A

DomainStartEndE-ValueType
Pfam:Med26 27 77 5.1e-17 PFAM
low complexity region 112 127 N/A INTRINSIC
TFS2M 134 235 4.14e-51 SMART
ZnF_C2C2 257 296 7.37e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129686
Predicted Effect probably benign
Transcript: ENSMUST00000129745
AA Change: T112A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119646
Gene: ENSMUSG00000059540
AA Change: T112A

DomainStartEndE-ValueType
Pfam:Med26 21 73 2.1e-20 PFAM
low complexity region 107 122 N/A INTRINSIC
TFS2M 129 230 4.14e-51 SMART
ZnF_C2C2 252 291 7.37e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130712
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143510
Predicted Effect probably benign
Transcript: ENSMUST00000144476
SMART Domains Protein: ENSMUSP00000120723
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
Pfam:RGS 1 49 3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165416
SMART Domains Protein: ENSMUSP00000129026
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
RGS 90 206 2.73e-43 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in the nucleus, where it functions as an SII class transcription elongation factor. Elongation factors in this class are responsible for releasing RNA polymerase II ternary complexes from transcriptional arrest at template-encoded arresting sites. The encoded protein has been shown to interact with general transcription factor IIB, a basal transcription factor. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T G 15: 60,919,633 probably benign Het
Abcg4 T G 9: 44,277,649 probably benign Het
Afm C A 5: 90,545,384 probably benign Het
Ahrr G A 13: 74,283,024 probably benign Het
Aplnr T A 2: 85,137,276 probably null Het
Arih2 T A 9: 108,611,727 H264L probably damaging Het
Atp1a1 A T 3: 101,579,835 I886N possibly damaging Het
Bmf A T 2: 118,549,622 V14E probably damaging Het
Ccdc116 T C 16: 17,144,039 E15G probably damaging Het
Ccdc175 T C 12: 72,135,965 N427D possibly damaging Het
Cfap53 A G 18: 74,299,176 H45R probably benign Het
Chd3 A G 11: 69,349,906 L1569P probably damaging Het
Cntn2 G A 1: 132,516,180 Q457* probably null Het
Coro1a A T 7: 126,701,413 probably benign Het
Cracr2b T A 7: 141,463,759 L91Q probably damaging Het
Ctdspl T C 9: 119,020,046 probably null Het
Dip2b T A 15: 100,169,312 L565Q probably damaging Het
Dip2c T A 13: 9,621,903 C1004S probably damaging Het
Dnah11 A T 12: 118,045,522 I2135N possibly damaging Het
Dnah14 A G 1: 181,769,407 probably benign Het
Dnase1 T C 16: 4,038,946 V147A probably damaging Het
Dusp8 T C 7: 142,082,054 probably benign Het
Fer1l6 T C 15: 58,662,787 Y1828H probably damaging Het
Flvcr1 A G 1: 191,008,191 V544A probably benign Het
Fsd1l T C 4: 53,687,209 V311A probably benign Het
Glud1 G A 14: 34,334,268 G300S probably benign Het
Gm4847 C T 1: 166,630,486 V433I probably benign Het
Gstm3 T G 3: 107,967,840 Y62S probably damaging Het
Gtse1 C T 15: 85,862,435 P151S probably benign Het
Herc2 T C 7: 56,207,812 S4048P probably benign Het
Hp1bp3 T A 4: 138,221,683 I19K probably benign Het
Htr7 C A 19: 36,041,540 probably benign Het
Il1a C T 2: 129,309,074 D10N probably damaging Het
Il22ra2 A T 10: 19,624,458 N39I probably damaging Het
Kcnn4 T C 7: 24,379,255 C267R possibly damaging Het
Larp1 A G 11: 58,055,473 K879R possibly damaging Het
Lcn5 T A 2: 25,661,405 probably benign Het
Lep T A 6: 29,068,972 C7* probably null Het
Magi2 A T 5: 20,611,055 Y747F probably benign Het
Mast4 T C 13: 102,742,058 T1223A probably damaging Het
Mcc C T 18: 44,445,933 E803K probably damaging Het
Mtmr4 T C 11: 87,611,508 I796T probably benign Het
Myef2 A T 2: 125,108,978 D312E probably benign Het
Myl3 A C 9: 110,767,929 D119A probably damaging Het
Myo19 T A 11: 84,888,169 probably null Het
Naa15 T G 3: 51,470,219 H763Q probably damaging Het
Pde5a C T 3: 122,824,902 probably benign Het
Plpp2 C T 10: 79,527,244 R184H probably benign Het
Rab19 T G 6: 39,389,687 L179V probably damaging Het
Rims2 T A 15: 39,534,966 M1087K probably damaging Het
Riox2 C A 16: 59,489,367 D361E probably benign Het
Sh3rf1 T A 8: 61,226,293 V123E probably damaging Het
Slc35e1 A T 8: 72,484,709 N318K probably damaging Het
Slc9a2 A T 1: 40,763,602 E604V probably benign Het
Srp72 T C 5: 76,987,885 S221P probably damaging Het
Tbx19 A T 1: 165,160,520 S15T possibly damaging Het
Tesk1 T A 4: 43,445,368 D230E probably damaging Het
Tm4sf5 C T 11: 70,510,712 A179V probably damaging Het
Tnr G T 1: 159,852,416 G320V probably damaging Het
Trappc11 A T 8: 47,503,320 C874S possibly damaging Het
Trpm3 T A 19: 22,914,446 Y885N probably damaging Het
Unc5a T A 13: 55,002,879 C505S probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Xpo5 T C 17: 46,204,786 probably benign Het
Zfp637 C A 6: 117,845,668 H252Q probably damaging Het
Zfp646 T A 7: 127,880,731 D693E probably damaging Het
Other mutations in Tcea2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02118:Tcea2 APN 2 181685835 missense probably benign 0.02
R0513:Tcea2 UTSW 2 181684481 missense probably benign 0.19
R0626:Tcea2 UTSW 2 181687638 missense probably damaging 1.00
R1228:Tcea2 UTSW 2 181684445 missense probably benign 0.11
R1540:Tcea2 UTSW 2 181686958 missense possibly damaging 0.55
R2095:Tcea2 UTSW 2 181686932 missense probably damaging 1.00
R4735:Tcea2 UTSW 2 181686721 missense probably damaging 1.00
R5499:Tcea2 UTSW 2 181680434 missense probably damaging 0.99
R7039:Tcea2 UTSW 2 181686918 nonsense probably null
R7411:Tcea2 UTSW 2 181686664 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCAATGCTCTACTCTGATGAGAC -3'
(R):5'- AAGACACAGATGTTGTGGTGACCC -3'

Sequencing Primer
(F):5'- ACACAGGCATTCTAGGCTG -3'
(R):5'- TGTTGTGGTGACCCCAAAAAC -3'
Posted On2013-05-23