Incidental Mutation 'R5306:Cep104'
ID 404550
Institutional Source Beutler Lab
Gene Symbol Cep104
Ensembl Gene ENSMUSG00000039523
Gene Name centrosomal protein 104
Synonyms
MMRRC Submission 042889-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.391) question?
Stock # R5306 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 153975194-154008732 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 154006242 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 884 (T884K)
Ref Sequence ENSEMBL: ENSMUSP00000040762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047497]
AlphaFold Q80V31
Predicted Effect probably benign
Transcript: ENSMUST00000047497
AA Change: T884K

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000040762
Gene: ENSMUSG00000039523
AA Change: T884K

DomainStartEndE-ValueType
coiled coil region 222 249 N/A INTRINSIC
low complexity region 288 301 N/A INTRINSIC
low complexity region 307 320 N/A INTRINSIC
SCOP:d1gw5b_ 523 646 3e-5 SMART
coiled coil region 688 730 N/A INTRINSIC
low complexity region 889 903 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000183790
AA Change: T490K
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein required for ciliogenesis and for ciliary tip structural integrity. The mammalian protein contains three amino-terminal hydrophobic domains, two glycosylation sites, four cysteine-rich motifs, and two regions with homology to the glutamate receptor ionotropic, NMDA 1 protein. During ciliogenesis, the encoded protein translocates from the distal tips of the centrioles to the tip of the elongating cilium. Knockdown of the protein in human retinal pigment cells results in severe defects in ciliogenesis with structural deformities at the ciliary tips. Allelic variants of this gene are associated with the autosomal-recessive disorder Joubert syndrome, which is characterized by a distinctive mid-hindbrain and cerebellar malformation, oculomotor apraxia, irregular breathing, developmental delay, and ataxia. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A G 19: 29,729,830 probably benign Het
Adam29 T A 8: 55,871,757 D554V probably damaging Het
Ankrd44 G A 1: 54,926,203 probably benign Het
Api5 A T 2: 94,423,466 C297* probably null Het
Asb14 G A 14: 26,911,909 C357Y probably damaging Het
Brdt T A 5: 107,345,144 D112E probably damaging Het
Capsl C A 15: 9,457,790 Q32K probably benign Het
Ccdc106 A G 7: 5,058,097 D81G probably damaging Het
Cmbl T C 15: 31,582,069 Y71H probably damaging Het
Crybg3 A T 16: 59,559,993 probably benign Het
Dynlt1c T C 17: 6,601,811 M1T probably null Het
Erbb2 T C 11: 98,428,206 S574P probably benign Het
Exosc10 T C 4: 148,562,392 V153A probably benign Het
Faxc G T 4: 21,931,557 probably benign Het
Fcgbp A G 7: 28,091,818 T835A probably damaging Het
Fmo5 G T 3: 97,641,760 M241I probably benign Het
Gabra1 A C 11: 42,133,552 I432S probably benign Het
Gfap A G 11: 102,895,748 probably null Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm12185 T A 11: 48,915,555 M270L probably benign Het
Gm14443 T C 2: 175,169,579 N358S possibly damaging Het
Gm6583 T C 5: 112,355,044 R265G probably benign Het
Gpr3 C T 4: 133,211,179 V61M probably damaging Het
Herc2 C T 7: 56,184,961 T3229M probably damaging Het
Ifit3 A G 19: 34,587,807 Y251C probably damaging Het
Inf2 G A 12: 112,601,553 V180I probably benign Het
Ints11 T C 4: 155,875,208 Y91H probably damaging Het
Ints4 A C 7: 97,509,678 D419A probably damaging Het
Kmt2e T C 5: 23,499,333 S1175P probably damaging Het
Mki67 A T 7: 135,714,001 V44E probably damaging Het
Mrgprb13 A T 7: 48,312,192 noncoding transcript Het
Myh2 T C 11: 67,186,556 L839P probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Olfr723 A G 14: 49,929,550 probably benign Het
Olfr814 A C 10: 129,873,941 I272R probably damaging Het
Pced1a T A 2: 130,419,171 H422L probably benign Het
Plpp1 G T 13: 112,851,555 probably null Het
Plxna4 T C 6: 32,206,121 Y949C probably damaging Het
Polg2 G A 11: 106,778,970 T158I probably damaging Het
Prss38 A T 11: 59,372,995 I297K probably benign Het
Psph A G 5: 129,769,367 L98P probably damaging Het
Rab11b G A 17: 33,760,269 probably benign Het
Rsf1 CGGCGGC CGGCGGCGGGGGCGGC 7: 97,579,929 probably benign Het
Serpine3 G A 14: 62,670,933 A137T probably damaging Het
Sh3bp4 T C 1: 89,144,275 F282L probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slco2b1 T A 7: 99,688,991 Y109F possibly damaging Het
Slfn10-ps T A 11: 83,035,529 noncoding transcript Het
Smc5 A G 19: 23,259,645 probably null Het
Smyd4 A G 11: 75,402,158 N638S probably benign Het
Stxbp5 T C 10: 9,799,991 E628G probably damaging Het
Tmem236 A T 2: 14,219,164 K255* probably null Het
Ttc29 T A 8: 78,251,910 probably null Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Tyr A G 7: 87,438,014 I430T probably damaging Het
Uckl1 A G 2: 181,574,367 probably null Het
Vmn2r52 A C 7: 10,170,745 I389R possibly damaging Het
Wdr62 A T 7: 30,265,263 F352Y possibly damaging Het
Wdr70 T C 15: 7,924,273 D379G probably benign Het
Zfp408 T A 2: 91,646,345 M155L probably benign Het
Zfp459 T A 13: 67,413,130 Q66H probably damaging Het
Zfp870 C A 17: 32,883,653 G234V probably damaging Het
Other mutations in Cep104
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02755:Cep104 APN 4 153996959 missense possibly damaging 0.93
IGL02884:Cep104 APN 4 153989862 missense probably damaging 0.96
IGL02928:Cep104 APN 4 153981259 missense probably benign 0.18
IGL03119:Cep104 APN 4 153981724 missense probably damaging 1.00
R0409:Cep104 UTSW 4 153983053 splice site probably benign
R0505:Cep104 UTSW 4 153996304 missense probably benign 0.00
R0600:Cep104 UTSW 4 154006792 missense possibly damaging 0.58
R1208:Cep104 UTSW 4 153985379 missense probably damaging 1.00
R1208:Cep104 UTSW 4 153985379 missense probably damaging 1.00
R1221:Cep104 UTSW 4 153988445 missense probably benign 0.00
R1338:Cep104 UTSW 4 153994508 missense probably benign 0.01
R1528:Cep104 UTSW 4 153994508 missense probably benign 0.01
R1648:Cep104 UTSW 4 153979096 critical splice donor site probably null
R1831:Cep104 UTSW 4 154002546 missense probably benign 0.30
R1832:Cep104 UTSW 4 154002546 missense probably benign 0.30
R1911:Cep104 UTSW 4 154006798 missense possibly damaging 0.74
R1914:Cep104 UTSW 4 153989839 missense possibly damaging 0.79
R2516:Cep104 UTSW 4 153989146 missense probably damaging 1.00
R2910:Cep104 UTSW 4 153995427 splice site probably null
R2911:Cep104 UTSW 4 153995427 splice site probably null
R3751:Cep104 UTSW 4 153981756 missense probably damaging 1.00
R3828:Cep104 UTSW 4 153984943 missense probably damaging 1.00
R3829:Cep104 UTSW 4 153984943 missense probably damaging 1.00
R3830:Cep104 UTSW 4 153984943 missense probably damaging 1.00
R4474:Cep104 UTSW 4 153989236 missense possibly damaging 0.47
R4731:Cep104 UTSW 4 153988426 missense probably damaging 1.00
R4732:Cep104 UTSW 4 153988426 missense probably damaging 1.00
R4733:Cep104 UTSW 4 153988426 missense probably damaging 1.00
R5449:Cep104 UTSW 4 153985305 splice site probably null
R5567:Cep104 UTSW 4 154002277 missense possibly damaging 0.64
R5761:Cep104 UTSW 4 153981224 missense possibly damaging 0.63
R5980:Cep104 UTSW 4 153988473 missense probably benign 0.00
R7003:Cep104 UTSW 4 153993561 missense probably benign 0.00
R7179:Cep104 UTSW 4 153992867 missense probably damaging 0.99
R7376:Cep104 UTSW 4 153983052 splice site probably null
R8278:Cep104 UTSW 4 153983665 missense possibly damaging 0.92
R8877:Cep104 UTSW 4 153993528 missense probably damaging 0.98
R9035:Cep104 UTSW 4 153979005 missense probably benign 0.39
R9060:Cep104 UTSW 4 153989824 missense probably damaging 0.98
R9165:Cep104 UTSW 4 153994514 critical splice donor site probably null
X0026:Cep104 UTSW 4 153986885 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAGGTTCTAAGGACAAAGACG -3'
(R):5'- AGCTGTGGGGACATCACTAG -3'

Sequencing Primer
(F):5'- GGCAGGAACCATGCTTCCAAG -3'
(R):5'- GACATCACTAGCCCTGGTG -3'
Posted On 2016-07-22